Incidental Mutation 'R2082:Cdk9'
ID230055
Institutional Source Beutler Lab
Gene Symbol Cdk9
Ensembl Gene ENSMUSG00000009555
Gene Namecyclin-dependent kinase 9 (CDC2-related kinase)
SynonymsPITALRE
MMRRC Submission 040087-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2082 (G1)
Quality Score183
Status Not validated
Chromosome2
Chromosomal Location32705784-32713076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32709501 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 189 (L189P)
Ref Sequence ENSEMBL: ENSMUSP00000113327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009699] [ENSMUST00000120105] [ENSMUST00000123170] [ENSMUST00000154131] [ENSMUST00000155205]
Predicted Effect probably damaging
Transcript: ENSMUST00000009699
AA Change: L240P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009699
Gene: ENSMUSG00000009555
AA Change: L240P

DomainStartEndE-ValueType
S_TKc 19 315 9.28e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120105
AA Change: L189P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113327
Gene: ENSMUSG00000009555
AA Change: L189P

DomainStartEndE-ValueType
Pfam:Pkinase 1 264 9.8e-58 PFAM
Pfam:Pkinase_Tyr 2 215 1.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144210
Predicted Effect probably benign
Transcript: ENSMUST00000154131
SMART Domains Protein: ENSMUSP00000120857
Gene: ENSMUSG00000009555

DomainStartEndE-ValueType
Pfam:Pkinase 19 61 8.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155205
SMART Domains Protein: ENSMUSP00000115299
Gene: ENSMUSG00000009555

DomainStartEndE-ValueType
Pfam:Pkinase 1 54 8.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198213
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,796,379 probably null Het
4933427I04Rik A G 4: 123,860,976 I228V probably benign Het
Aco2 T C 15: 81,913,695 W657R possibly damaging Het
Acsm2 T A 7: 119,580,634 H333Q probably benign Het
Adamts18 C T 8: 113,775,333 V299I probably damaging Het
Adat2 G A 10: 13,560,163 C84Y probably damaging Het
Arhgef11 C T 3: 87,725,996 T690I possibly damaging Het
Cachd1 A G 4: 101,002,958 D1242G probably damaging Het
Casp14 A G 10: 78,715,033 M106T probably benign Het
Ccdc69 T A 11: 55,052,389 I130F probably damaging Het
Cfhr1 C T 1: 139,550,886 V249I possibly damaging Het
Chst1 T C 2: 92,613,990 V269A possibly damaging Het
Col18a1 G T 10: 77,059,293 P1178Q probably damaging Het
Col6a1 A G 10: 76,709,596 L1014P probably damaging Het
Crisp3 T C 17: 40,225,860 Y188C probably damaging Het
Dse G A 10: 34,155,940 R363C probably damaging Het
Exoc5 T C 14: 49,015,587 I525V probably benign Het
Fech A T 18: 64,458,189 I388N probably damaging Het
Fmnl1 T C 11: 103,192,025 L363P probably damaging Het
Gm10842 T A 11: 105,147,083 L64Q unknown Het
Gm8225 C A 17: 26,543,696 P287Q possibly damaging Het
Hsp90aa1 A T 12: 110,692,827 L512H probably damaging Het
Ifi30 T C 8: 70,763,728 probably benign Het
Iqsec1 A T 6: 90,694,574 D115E probably damaging Het
Kcnu1 T A 8: 25,921,549 L174H probably damaging Het
Krt10 A G 11: 99,388,875 V153A probably damaging Het
Krt18 G A 15: 102,031,020 probably null Het
Micu1 A G 10: 59,863,307 T469A probably benign Het
Mtss1l T C 8: 110,726,257 probably null Het
Myo10 T A 15: 25,785,993 F1253L probably damaging Het
N4bp2 A T 5: 65,807,565 T986S probably damaging Het
Naip6 C A 13: 100,304,344 probably null Het
Nphp4 G A 4: 152,559,364 V1117M probably benign Het
Oca2 C A 7: 56,297,137 Q305K probably benign Het
Olfr195 T A 16: 59,148,885 F12I probably damaging Het
Olfr688 C T 7: 105,288,503 Q137* probably null Het
Olfr845 G A 9: 19,339,278 V273I probably benign Het
P2rx7 A T 5: 122,644,095 N8Y possibly damaging Het
Pag1 A T 3: 9,699,485 S203T probably damaging Het
Pfn4 T A 12: 4,775,439 probably null Het
Pip4k2c T C 10: 127,199,089 D414G probably damaging Het
Pkp1 T G 1: 135,884,976 Q329P possibly damaging Het
Polrmt A T 10: 79,743,512 I135N probably benign Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Ppp3cb T C 14: 20,508,678 T439A possibly damaging Het
Prkdc A G 16: 15,715,963 Y1555C probably damaging Het
Ptprh T C 7: 4,550,775 D859G probably damaging Het
Sema5a T A 15: 32,618,856 M510K probably benign Het
Slc22a16 A G 10: 40,585,339 E379G probably benign Het
Slc30a5 C A 13: 100,806,533 probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tbc1d9 A T 8: 83,270,987 S1058C probably damaging Het
Tet2 A G 3: 133,485,727 L982P possibly damaging Het
Tmem101 G T 11: 102,153,377 T228K probably benign Het
Tshz2 G T 2: 169,886,215 K441N probably damaging Het
Upf1 A T 8: 70,341,572 I228N probably damaging Het
Usp32 A T 11: 85,030,512 I692N probably damaging Het
Vmn2r117 A G 17: 23,460,256 S665P possibly damaging Het
Vps13b T C 15: 35,910,746 V3552A possibly damaging Het
Vps35 A T 8: 85,263,465 M638K possibly damaging Het
Vps41 T G 13: 18,852,351 I645S probably benign Het
Zfp703 T C 8: 26,978,988 S227P probably benign Het
Other mutations in Cdk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Cdk9 APN 2 32708051 missense possibly damaging 0.77
R0321:Cdk9 UTSW 2 32712686 unclassified probably benign
R0615:Cdk9 UTSW 2 32709801 missense possibly damaging 0.92
R0624:Cdk9 UTSW 2 32709824 missense probably damaging 1.00
R0661:Cdk9 UTSW 2 32709820 missense probably damaging 1.00
R1525:Cdk9 UTSW 2 32710509 missense probably damaging 0.97
R4416:Cdk9 UTSW 2 32708072 missense probably damaging 1.00
R6047:Cdk9 UTSW 2 32708273 unclassified probably null
R7391:Cdk9 UTSW 2 32712071 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCGGCAACAGAGAGCTCATAC -3'
(R):5'- GTGCCTTCAGCCTAGCTAAG -3'

Sequencing Primer
(F):5'- CCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- GTGCCTTCAGCCTAGCTAAGAATAG -3'
Posted On2014-09-18