Incidental Mutation 'R2082:Chst1'
ID230056
Institutional Source Beutler Lab
Gene Symbol Chst1
Ensembl Gene ENSMUSG00000027221
Gene Namecarbohydrate (keratan sulfate Gal-6) sulfotransferase 1
SynonymsC6ST, KSGAL6ST, 2610008E20Rik, GST-1
MMRRC Submission 040087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R2082 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location92599707-92615250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92613990 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 269 (V269A)
Ref Sequence ENSEMBL: ENSMUSP00000064246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065797]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065797
AA Change: V269A

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064246
Gene: ENSMUSG00000027221
AA Change: V269A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sulfotransfer_1 60 384 7.1e-64 PFAM
Pfam:Sulfotransfer_3 61 323 1.7e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the keratin sulfotransferase family of proteins. The encoded enzyme catalyzes the sulfation of the proteoglycan keratin. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased male sibling aggression when house together, a small decrease in the peripheral and mesenteric lymph nodes and peripheral blood and a small increase in the peripheral lymph nodes and peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,796,379 probably null Het
4933427I04Rik A G 4: 123,860,976 I228V probably benign Het
Aco2 T C 15: 81,913,695 W657R possibly damaging Het
Acsm2 T A 7: 119,580,634 H333Q probably benign Het
Adamts18 C T 8: 113,775,333 V299I probably damaging Het
Adat2 G A 10: 13,560,163 C84Y probably damaging Het
Arhgef11 C T 3: 87,725,996 T690I possibly damaging Het
Cachd1 A G 4: 101,002,958 D1242G probably damaging Het
Casp14 A G 10: 78,715,033 M106T probably benign Het
Ccdc69 T A 11: 55,052,389 I130F probably damaging Het
Cdk9 A G 2: 32,709,501 L189P probably damaging Het
Cfhr1 C T 1: 139,550,886 V249I possibly damaging Het
Col18a1 G T 10: 77,059,293 P1178Q probably damaging Het
Col6a1 A G 10: 76,709,596 L1014P probably damaging Het
Crisp3 T C 17: 40,225,860 Y188C probably damaging Het
Dse G A 10: 34,155,940 R363C probably damaging Het
Exoc5 T C 14: 49,015,587 I525V probably benign Het
Fech A T 18: 64,458,189 I388N probably damaging Het
Fmnl1 T C 11: 103,192,025 L363P probably damaging Het
Gm10842 T A 11: 105,147,083 L64Q unknown Het
Gm8225 C A 17: 26,543,696 P287Q possibly damaging Het
Hsp90aa1 A T 12: 110,692,827 L512H probably damaging Het
Ifi30 T C 8: 70,763,728 probably benign Het
Iqsec1 A T 6: 90,694,574 D115E probably damaging Het
Kcnu1 T A 8: 25,921,549 L174H probably damaging Het
Krt10 A G 11: 99,388,875 V153A probably damaging Het
Krt18 G A 15: 102,031,020 probably null Het
Micu1 A G 10: 59,863,307 T469A probably benign Het
Mtss1l T C 8: 110,726,257 probably null Het
Myo10 T A 15: 25,785,993 F1253L probably damaging Het
N4bp2 A T 5: 65,807,565 T986S probably damaging Het
Naip6 C A 13: 100,304,344 probably null Het
Nphp4 G A 4: 152,559,364 V1117M probably benign Het
Oca2 C A 7: 56,297,137 Q305K probably benign Het
Olfr195 T A 16: 59,148,885 F12I probably damaging Het
Olfr688 C T 7: 105,288,503 Q137* probably null Het
Olfr845 G A 9: 19,339,278 V273I probably benign Het
P2rx7 A T 5: 122,644,095 N8Y possibly damaging Het
Pag1 A T 3: 9,699,485 S203T probably damaging Het
Pfn4 T A 12: 4,775,439 probably null Het
Pip4k2c T C 10: 127,199,089 D414G probably damaging Het
Pkp1 T G 1: 135,884,976 Q329P possibly damaging Het
Polrmt A T 10: 79,743,512 I135N probably benign Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Ppp3cb T C 14: 20,508,678 T439A possibly damaging Het
Prkdc A G 16: 15,715,963 Y1555C probably damaging Het
Ptprh T C 7: 4,550,775 D859G probably damaging Het
Sema5a T A 15: 32,618,856 M510K probably benign Het
Slc22a16 A G 10: 40,585,339 E379G probably benign Het
Slc30a5 C A 13: 100,806,533 probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tbc1d9 A T 8: 83,270,987 S1058C probably damaging Het
Tet2 A G 3: 133,485,727 L982P possibly damaging Het
Tmem101 G T 11: 102,153,377 T228K probably benign Het
Tshz2 G T 2: 169,886,215 K441N probably damaging Het
Upf1 A T 8: 70,341,572 I228N probably damaging Het
Usp32 A T 11: 85,030,512 I692N probably damaging Het
Vmn2r117 A G 17: 23,460,256 S665P possibly damaging Het
Vps13b T C 15: 35,910,746 V3552A possibly damaging Het
Vps35 A T 8: 85,263,465 M638K possibly damaging Het
Vps41 T G 13: 18,852,351 I645S probably benign Het
Zfp703 T C 8: 26,978,988 S227P probably benign Het
Other mutations in Chst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Chst1 APN 2 92614130 missense probably damaging 0.98
IGL02339:Chst1 APN 2 92613577 missense possibly damaging 0.74
IGL03082:Chst1 APN 2 92613933 missense possibly damaging 0.77
IGL03111:Chst1 APN 2 92613347 missense possibly damaging 0.85
R0267:Chst1 UTSW 2 92613606 missense probably damaging 1.00
R0294:Chst1 UTSW 2 92613642 missense probably damaging 1.00
R0504:Chst1 UTSW 2 92613824 missense probably benign 0.20
R0707:Chst1 UTSW 2 92613619 missense possibly damaging 0.88
R1302:Chst1 UTSW 2 92613519 missense probably damaging 1.00
R4891:Chst1 UTSW 2 92613992 missense possibly damaging 0.48
R5352:Chst1 UTSW 2 92613365 missense possibly damaging 0.75
R6766:Chst1 UTSW 2 92613197 missense probably damaging 1.00
R6891:Chst1 UTSW 2 92613743 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCATGTGGCCATCAAGAC -3'
(R):5'- TTCTGGATCCAGTGTGCCAC -3'

Sequencing Primer
(F):5'- ATGTGGCCATCAAGACTGTGC -3'
(R):5'- ATCCAGTGTGCCACGTGACTG -3'
Posted On2014-09-18