Mutagenetix > Incidental Mutation

Incidental Mutation 'R2082:Upf1'

230078

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

040087-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R2082 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70341572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 228 (I228N)

Ref Sequence

ENSEMBL: ENSMUSP00000148927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably damaging
Transcript: ENSMUST00000075666
AA Change: I228N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: I228N

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215817
AA Change: I228N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	A	2: 30,796,379		probably null	Het
4933427I04Rik	A	G	4: 123,860,976	I228V	probably benign	Het
Aco2	T	C	15: 81,913,695	W657R	possibly damaging	Het
Acsm2	T	A	7: 119,580,634	H333Q	probably benign	Het
Adamts18	C	T	8: 113,775,333	V299I	probably damaging	Het
Adat2	G	A	10: 13,560,163	C84Y	probably damaging	Het
Arhgef11	C	T	3: 87,725,996	T690I	possibly damaging	Het
Cachd1	A	G	4: 101,002,958	D1242G	probably damaging	Het
Casp14	A	G	10: 78,715,033	M106T	probably benign	Het
Ccdc69	T	A	11: 55,052,389	I130F	probably damaging	Het
Cdk9	A	G	2: 32,709,501	L189P	probably damaging	Het
Cfhr1	C	T	1: 139,550,886	V249I	possibly damaging	Het
Chst1	T	C	2: 92,613,990	V269A	possibly damaging	Het
Col18a1	G	T	10: 77,059,293	P1178Q	probably damaging	Het
Col6a1	A	G	10: 76,709,596	L1014P	probably damaging	Het
Crisp3	T	C	17: 40,225,860	Y188C	probably damaging	Het
Dse	G	A	10: 34,155,940	R363C	probably damaging	Het
Exoc5	T	C	14: 49,015,587	I525V	probably benign	Het
Fech	A	T	18: 64,458,189	I388N	probably damaging	Het
Fmnl1	T	C	11: 103,192,025	L363P	probably damaging	Het
Gm10842	T	A	11: 105,147,083	L64Q	unknown	Het
Gm8225	C	A	17: 26,543,696	P287Q	possibly damaging	Het
Hsp90aa1	A	T	12: 110,692,827	L512H	probably damaging	Het
Ifi30	T	C	8: 70,763,728		probably benign	Het
Iqsec1	A	T	6: 90,694,574	D115E	probably damaging	Het
Kcnu1	T	A	8: 25,921,549	L174H	probably damaging	Het
Krt10	A	G	11: 99,388,875	V153A	probably damaging	Het
Krt18	G	A	15: 102,031,020		probably null	Het
Micu1	A	G	10: 59,863,307	T469A	probably benign	Het
Mtss1l	T	C	8: 110,726,257		probably null	Het
Myo10	T	A	15: 25,785,993	F1253L	probably damaging	Het
N4bp2	A	T	5: 65,807,565	T986S	probably damaging	Het
Naip6	C	A	13: 100,304,344		probably null	Het
Nphp4	G	A	4: 152,559,364	V1117M	probably benign	Het
Oca2	C	A	7: 56,297,137	Q305K	probably benign	Het
Olfr195	T	A	16: 59,148,885	F12I	probably damaging	Het
Olfr688	C	T	7: 105,288,503	Q137*	probably null	Het
Olfr845	G	A	9: 19,339,278	V273I	probably benign	Het
P2rx7	A	T	5: 122,644,095	N8Y	possibly damaging	Het
Pag1	A	T	3: 9,699,485	S203T	probably damaging	Het
Pfn4	T	A	12: 4,775,439		probably null	Het
Pip4k2c	T	C	10: 127,199,089	D414G	probably damaging	Het
Pkp1	T	G	1: 135,884,976	Q329P	possibly damaging	Het
Polrmt	A	T	10: 79,743,512	I135N	probably benign	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Ppp3cb	T	C	14: 20,508,678	T439A	possibly damaging	Het
Prkdc	A	G	16: 15,715,963	Y1555C	probably damaging	Het
Ptprh	T	C	7: 4,550,775	D859G	probably damaging	Het
Sema5a	T	A	15: 32,618,856	M510K	probably benign	Het
Slc22a16	A	G	10: 40,585,339	E379G	probably benign	Het
Slc30a5	C	A	13: 100,806,533		probably null	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tbc1d9	A	T	8: 83,270,987	S1058C	probably damaging	Het
Tet2	A	G	3: 133,485,727	L982P	possibly damaging	Het
Tmem101	G	T	11: 102,153,377	T228K	probably benign	Het
Tshz2	G	T	2: 169,886,215	K441N	probably damaging	Het
Usp32	A	T	11: 85,030,512	I692N	probably damaging	Het
Vmn2r117	A	G	17: 23,460,256	S665P	possibly damaging	Het
Vps13b	T	C	15: 35,910,746	V3552A	possibly damaging	Het
Vps35	A	T	8: 85,263,465	M638K	possibly damaging	Het
Vps41	T	G	13: 18,852,351	I645S	probably benign	Het
Zfp703	T	C	8: 26,978,988	S227P	probably benign	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ATCCACTATGTCCCCTGCAG -3'
(R):5'- TGACAGGTCTGCTGTGAAC -3'

Sequencing Primer
(F):5'- TGCAGAGCCCTAGGTCATGTC -3'
(R):5'- TCTGCTGTGAACTGAGGCCAG -3'

Posted On

2014-09-18