Incidental Mutation 'R2082:Olfr845'
ID230084
Institutional Source Beutler Lab
Gene Symbol Olfr845
Ensembl Gene ENSMUSG00000061614
Gene Nameolfactory receptor 845
SynonymsOlfr1522-ps1, MOR150-2, MOR150-1P, GA_x6K02T2PVTD-13076685-13077623, MOR150-1P, MOR150-1
MMRRC Submission 040087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R2082 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19336457-19341718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19339278 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 273 (V273I)
Ref Sequence ENSEMBL: ENSMUSP00000150474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071259] [ENSMUST00000213344] [ENSMUST00000215572]
Predicted Effect probably benign
Transcript: ENSMUST00000071259
AA Change: V273I

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071239
Gene: ENSMUSG00000061614
AA Change: V273I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212246
AA Change: V273I
Predicted Effect probably benign
Transcript: ENSMUST00000213344
AA Change: V273I

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215572
AA Change: V273I

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,796,379 probably null Het
4933427I04Rik A G 4: 123,860,976 I228V probably benign Het
Aco2 T C 15: 81,913,695 W657R possibly damaging Het
Acsm2 T A 7: 119,580,634 H333Q probably benign Het
Adamts18 C T 8: 113,775,333 V299I probably damaging Het
Adat2 G A 10: 13,560,163 C84Y probably damaging Het
Arhgef11 C T 3: 87,725,996 T690I possibly damaging Het
Cachd1 A G 4: 101,002,958 D1242G probably damaging Het
Casp14 A G 10: 78,715,033 M106T probably benign Het
Ccdc69 T A 11: 55,052,389 I130F probably damaging Het
Cdk9 A G 2: 32,709,501 L189P probably damaging Het
Cfhr1 C T 1: 139,550,886 V249I possibly damaging Het
Chst1 T C 2: 92,613,990 V269A possibly damaging Het
Col18a1 G T 10: 77,059,293 P1178Q probably damaging Het
Col6a1 A G 10: 76,709,596 L1014P probably damaging Het
Crisp3 T C 17: 40,225,860 Y188C probably damaging Het
Dse G A 10: 34,155,940 R363C probably damaging Het
Exoc5 T C 14: 49,015,587 I525V probably benign Het
Fech A T 18: 64,458,189 I388N probably damaging Het
Fmnl1 T C 11: 103,192,025 L363P probably damaging Het
Gm10842 T A 11: 105,147,083 L64Q unknown Het
Gm8225 C A 17: 26,543,696 P287Q possibly damaging Het
Hsp90aa1 A T 12: 110,692,827 L512H probably damaging Het
Ifi30 T C 8: 70,763,728 probably benign Het
Iqsec1 A T 6: 90,694,574 D115E probably damaging Het
Kcnu1 T A 8: 25,921,549 L174H probably damaging Het
Krt10 A G 11: 99,388,875 V153A probably damaging Het
Krt18 G A 15: 102,031,020 probably null Het
Micu1 A G 10: 59,863,307 T469A probably benign Het
Mtss1l T C 8: 110,726,257 probably null Het
Myo10 T A 15: 25,785,993 F1253L probably damaging Het
N4bp2 A T 5: 65,807,565 T986S probably damaging Het
Naip6 C A 13: 100,304,344 probably null Het
Nphp4 G A 4: 152,559,364 V1117M probably benign Het
Oca2 C A 7: 56,297,137 Q305K probably benign Het
Olfr195 T A 16: 59,148,885 F12I probably damaging Het
Olfr688 C T 7: 105,288,503 Q137* probably null Het
P2rx7 A T 5: 122,644,095 N8Y possibly damaging Het
Pag1 A T 3: 9,699,485 S203T probably damaging Het
Pfn4 T A 12: 4,775,439 probably null Het
Pip4k2c T C 10: 127,199,089 D414G probably damaging Het
Pkp1 T G 1: 135,884,976 Q329P possibly damaging Het
Polrmt A T 10: 79,743,512 I135N probably benign Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Ppp3cb T C 14: 20,508,678 T439A possibly damaging Het
Prkdc A G 16: 15,715,963 Y1555C probably damaging Het
Ptprh T C 7: 4,550,775 D859G probably damaging Het
Sema5a T A 15: 32,618,856 M510K probably benign Het
Slc22a16 A G 10: 40,585,339 E379G probably benign Het
Slc30a5 C A 13: 100,806,533 probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tbc1d9 A T 8: 83,270,987 S1058C probably damaging Het
Tet2 A G 3: 133,485,727 L982P possibly damaging Het
Tmem101 G T 11: 102,153,377 T228K probably benign Het
Tshz2 G T 2: 169,886,215 K441N probably damaging Het
Upf1 A T 8: 70,341,572 I228N probably damaging Het
Usp32 A T 11: 85,030,512 I692N probably damaging Het
Vmn2r117 A G 17: 23,460,256 S665P possibly damaging Het
Vps13b T C 15: 35,910,746 V3552A possibly damaging Het
Vps35 A T 8: 85,263,465 M638K possibly damaging Het
Vps41 T G 13: 18,852,351 I645S probably benign Het
Zfp703 T C 8: 26,978,988 S227P probably benign Het
Other mutations in Olfr845
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr845 APN 9 19338772 missense possibly damaging 0.56
IGL01637:Olfr845 APN 9 19338964 missense probably damaging 1.00
IGL01767:Olfr845 APN 9 19339302 missense possibly damaging 0.54
IGL01945:Olfr845 APN 9 19339332 missense probably damaging 0.98
IGL02202:Olfr845 APN 9 19339249 missense probably benign 0.06
IGL02877:Olfr845 APN 9 19339201 missense possibly damaging 0.86
R0466:Olfr845 UTSW 9 19339179 missense probably damaging 1.00
R1521:Olfr845 UTSW 9 19338652 missense probably benign 0.35
R1650:Olfr845 UTSW 9 19338647 missense possibly damaging 0.49
R1766:Olfr845 UTSW 9 19338858 missense probably benign 0.06
R2060:Olfr845 UTSW 9 19339056 missense probably benign 0.01
R2257:Olfr845 UTSW 9 19338493 missense probably benign 0.01
R2892:Olfr845 UTSW 9 19338738 missense probably benign 0.04
R3156:Olfr845 UTSW 9 19339424 unclassified probably null
R3943:Olfr845 UTSW 9 19339075 missense probably benign 0.05
R4116:Olfr845 UTSW 9 19338644 missense probably benign 0.39
R4518:Olfr845 UTSW 9 19339260 missense possibly damaging 0.86
R4814:Olfr845 UTSW 9 19339180 missense probably damaging 1.00
R5339:Olfr845 UTSW 9 19339159 missense possibly damaging 0.78
R6647:Olfr845 UTSW 9 19338629 missense possibly damaging 0.50
R7493:Olfr845 UTSW 9 19338813 missense probably damaging 0.98
R7522:Olfr845 UTSW 9 19338998 nonsense probably null
R7584:Olfr845 UTSW 9 19339273 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTTGCCTGCTCAGATACTC -3'
(R):5'- CCCTTGAAATCCAGCCACTATGG -3'

Sequencing Primer
(F):5'- ATATCTCAGCTTTCATGTTTGGTG -3'
(R):5'- GTGCTTCCTTAAAGCTTCC -3'
Posted On2014-09-18