Incidental Mutation 'R2082:Col6a1'
ID230089
Institutional Source Beutler Lab
Gene Symbol Col6a1
Ensembl Gene ENSMUSG00000001119
Gene Namecollagen, type VI, alpha 1
SynonymsCol6a-1
MMRRC Submission 040087-MU
Accession Numbers

Ncbi RefSeq: NM_009933.4; MGI: 88459

Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R2082 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76708792-76726168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76709596 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1014 (L1014P)
Ref Sequence ENSEMBL: ENSMUSP00000001147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001147]
Predicted Effect probably damaging
Transcript: ENSMUST00000001147
AA Change: L1014P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119
AA Change: L1014P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 34 232 9.55e-29 SMART
Pfam:Collagen 252 312 5.6e-11 PFAM
Pfam:Collagen 292 367 2e-9 PFAM
Pfam:Collagen 345 423 3.6e-8 PFAM
Pfam:Collagen 448 515 1.1e-8 PFAM
Pfam:Collagen 499 563 1.9e-9 PFAM
low complexity region 571 590 N/A INTRINSIC
VWA 612 798 8.57e-31 SMART
VWA 824 1005 2.6e-30 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype Strain: 2153356
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,796,379 probably null Het
4933427I04Rik A G 4: 123,860,976 I228V probably benign Het
Aco2 T C 15: 81,913,695 W657R possibly damaging Het
Acsm2 T A 7: 119,580,634 H333Q probably benign Het
Adamts18 C T 8: 113,775,333 V299I probably damaging Het
Adat2 G A 10: 13,560,163 C84Y probably damaging Het
Arhgef11 C T 3: 87,725,996 T690I possibly damaging Het
Cachd1 A G 4: 101,002,958 D1242G probably damaging Het
Casp14 A G 10: 78,715,033 M106T probably benign Het
Ccdc69 T A 11: 55,052,389 I130F probably damaging Het
Cdk9 A G 2: 32,709,501 L189P probably damaging Het
Cfhr1 C T 1: 139,550,886 V249I possibly damaging Het
Chst1 T C 2: 92,613,990 V269A possibly damaging Het
Col18a1 G T 10: 77,059,293 P1178Q probably damaging Het
Crisp3 T C 17: 40,225,860 Y188C probably damaging Het
Dse G A 10: 34,155,940 R363C probably damaging Het
Exoc5 T C 14: 49,015,587 I525V probably benign Het
Fech A T 18: 64,458,189 I388N probably damaging Het
Fmnl1 T C 11: 103,192,025 L363P probably damaging Het
Gm10842 T A 11: 105,147,083 L64Q unknown Het
Gm8225 C A 17: 26,543,696 P287Q possibly damaging Het
Hsp90aa1 A T 12: 110,692,827 L512H probably damaging Het
Ifi30 T C 8: 70,763,728 probably benign Het
Iqsec1 A T 6: 90,694,574 D115E probably damaging Het
Kcnu1 T A 8: 25,921,549 L174H probably damaging Het
Krt10 A G 11: 99,388,875 V153A probably damaging Het
Krt18 G A 15: 102,031,020 probably null Het
Micu1 A G 10: 59,863,307 T469A probably benign Het
Mtss1l T C 8: 110,726,257 probably null Het
Myo10 T A 15: 25,785,993 F1253L probably damaging Het
N4bp2 A T 5: 65,807,565 T986S probably damaging Het
Naip6 C A 13: 100,304,344 probably null Het
Nphp4 G A 4: 152,559,364 V1117M probably benign Het
Oca2 C A 7: 56,297,137 Q305K probably benign Het
Olfr195 T A 16: 59,148,885 F12I probably damaging Het
Olfr688 C T 7: 105,288,503 Q137* probably null Het
Olfr845 G A 9: 19,339,278 V273I probably benign Het
P2rx7 A T 5: 122,644,095 N8Y possibly damaging Het
Pag1 A T 3: 9,699,485 S203T probably damaging Het
Pfn4 T A 12: 4,775,439 probably null Het
Pip4k2c T C 10: 127,199,089 D414G probably damaging Het
Pkp1 T G 1: 135,884,976 Q329P possibly damaging Het
Polrmt A T 10: 79,743,512 I135N probably benign Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Ppp3cb T C 14: 20,508,678 T439A possibly damaging Het
Prkdc A G 16: 15,715,963 Y1555C probably damaging Het
Ptprh T C 7: 4,550,775 D859G probably damaging Het
Sema5a T A 15: 32,618,856 M510K probably benign Het
Slc22a16 A G 10: 40,585,339 E379G probably benign Het
Slc30a5 C A 13: 100,806,533 probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tbc1d9 A T 8: 83,270,987 S1058C probably damaging Het
Tet2 A G 3: 133,485,727 L982P possibly damaging Het
Tmem101 G T 11: 102,153,377 T228K probably benign Het
Tshz2 G T 2: 169,886,215 K441N probably damaging Het
Upf1 A T 8: 70,341,572 I228N probably damaging Het
Usp32 A T 11: 85,030,512 I692N probably damaging Het
Vmn2r117 A G 17: 23,460,256 S665P possibly damaging Het
Vps13b T C 15: 35,910,746 V3552A possibly damaging Het
Vps35 A T 8: 85,263,465 M638K possibly damaging Het
Vps41 T G 13: 18,852,351 I645S probably benign Het
Zfp703 T C 8: 26,978,988 S227P probably benign Het
Other mutations in Col6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Col6a1 APN 10 76710979 missense unknown
IGL01943:Col6a1 APN 10 76719123 critical splice donor site probably null
IGL02178:Col6a1 APN 10 76711075 missense unknown
IGL02928:Col6a1 APN 10 76709666 missense possibly damaging 0.93
IGL03162:Col6a1 APN 10 76718051 splice site probably benign
P0005:Col6a1 UTSW 10 76717329 splice site probably benign
R0398:Col6a1 UTSW 10 76710118 missense unknown
R0631:Col6a1 UTSW 10 76709735 missense probably benign 0.03
R0698:Col6a1 UTSW 10 76716280 missense unknown
R0699:Col6a1 UTSW 10 76716280 missense unknown
R0848:Col6a1 UTSW 10 76713624 critical splice donor site probably null
R1053:Col6a1 UTSW 10 76720966 missense probably damaging 0.99
R1235:Col6a1 UTSW 10 76712324 missense unknown
R1480:Col6a1 UTSW 10 76709918 missense unknown
R1854:Col6a1 UTSW 10 76721949 missense probably damaging 1.00
R1995:Col6a1 UTSW 10 76721956 missense probably damaging 1.00
R2122:Col6a1 UTSW 10 76721498 missense probably benign 0.10
R2411:Col6a1 UTSW 10 76711088 missense unknown
R3236:Col6a1 UTSW 10 76711320 missense unknown
R3417:Col6a1 UTSW 10 76712369 missense unknown
R3832:Col6a1 UTSW 10 76711117 missense unknown
R3843:Col6a1 UTSW 10 76711341 missense unknown
R3903:Col6a1 UTSW 10 76711341 missense unknown
R3904:Col6a1 UTSW 10 76711341 missense unknown
R4409:Col6a1 UTSW 10 76721500 missense probably benign 0.17
R4418:Col6a1 UTSW 10 76718405 nonsense probably null
R4568:Col6a1 UTSW 10 76719197 intron probably benign
R4579:Col6a1 UTSW 10 76711357 missense unknown
R4661:Col6a1 UTSW 10 76714672 missense unknown
R4945:Col6a1 UTSW 10 76712272 missense unknown
R4958:Col6a1 UTSW 10 76723505 missense probably damaging 1.00
R5101:Col6a1 UTSW 10 76709906 missense unknown
R5440:Col6a1 UTSW 10 76723454 missense probably damaging 1.00
R5924:Col6a1 UTSW 10 76718371 critical splice donor site probably null
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6366:Col6a1 UTSW 10 76710970 missense unknown
R6435:Col6a1 UTSW 10 76711123 missense unknown
R6718:Col6a1 UTSW 10 76725050 missense probably damaging 1.00
R7014:Col6a1 UTSW 10 76721443 missense probably damaging 1.00
R7117:Col6a1 UTSW 10 76725009 missense probably damaging 1.00
R7153:Col6a1 UTSW 10 76710341 splice site probably null
R7183:Col6a1 UTSW 10 76716259 critical splice donor site probably null
R7244:Col6a1 UTSW 10 76717408 nonsense probably null
R7625:Col6a1 UTSW 10 76713926 missense unknown
X0010:Col6a1 UTSW 10 76723538 missense probably damaging 1.00
X0067:Col6a1 UTSW 10 76709975 missense unknown
Z1088:Col6a1 UTSW 10 76709559 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGCCACAGGGGACATTACAC -3'
(R):5'- CATTGAGAAGGCTGTGCAGG -3'

Sequencing Primer
(F):5'- CAAAGAGTGTGCATCTCAGCGTTC -3'
(R):5'- AAGGCTGTGCAGGAGGCC -3'
Posted On2014-09-18