Mutagenetix > Incidental Mutation

Incidental Mutation 'R2082:Hsp90aa1'

230102

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

MMRRC Submission

040087-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2082 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110692827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 512 (L512H)

Ref Sequence

ENSEMBL: ENSMUSP00000091921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

AlphaFold

P07901

Predicted Effect

probably damaging
Transcript: ENSMUST00000021698
AA Change: L512H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: L512H

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000094361
AA Change: L512H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: L512H

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124156

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145255

Predicted Effect

probably benign
Transcript: ENSMUST00000149189

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155242

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	A	2: 30,796,379		probably null	Het
4933427I04Rik	A	G	4: 123,860,976	I228V	probably benign	Het
Aco2	T	C	15: 81,913,695	W657R	possibly damaging	Het
Acsm2	T	A	7: 119,580,634	H333Q	probably benign	Het
Adamts18	C	T	8: 113,775,333	V299I	probably damaging	Het
Adat2	G	A	10: 13,560,163	C84Y	probably damaging	Het
Arhgef11	C	T	3: 87,725,996	T690I	possibly damaging	Het
Cachd1	A	G	4: 101,002,958	D1242G	probably damaging	Het
Casp14	A	G	10: 78,715,033	M106T	probably benign	Het
Ccdc69	T	A	11: 55,052,389	I130F	probably damaging	Het
Cdk9	A	G	2: 32,709,501	L189P	probably damaging	Het
Cfhr1	C	T	1: 139,550,886	V249I	possibly damaging	Het
Chst1	T	C	2: 92,613,990	V269A	possibly damaging	Het
Col18a1	G	T	10: 77,059,293	P1178Q	probably damaging	Het
Col6a1	A	G	10: 76,709,596	L1014P	probably damaging	Het
Crisp3	T	C	17: 40,225,860	Y188C	probably damaging	Het
Dse	G	A	10: 34,155,940	R363C	probably damaging	Het
Exoc5	T	C	14: 49,015,587	I525V	probably benign	Het
Fech	A	T	18: 64,458,189	I388N	probably damaging	Het
Fmnl1	T	C	11: 103,192,025	L363P	probably damaging	Het
Gm10842	T	A	11: 105,147,083	L64Q	unknown	Het
Gm8225	C	A	17: 26,543,696	P287Q	possibly damaging	Het
Ifi30	T	C	8: 70,763,728		probably benign	Het
Iqsec1	A	T	6: 90,694,574	D115E	probably damaging	Het
Kcnu1	T	A	8: 25,921,549	L174H	probably damaging	Het
Krt10	A	G	11: 99,388,875	V153A	probably damaging	Het
Krt18	G	A	15: 102,031,020		probably null	Het
Micu1	A	G	10: 59,863,307	T469A	probably benign	Het
Mtss1l	T	C	8: 110,726,257		probably null	Het
Myo10	T	A	15: 25,785,993	F1253L	probably damaging	Het
N4bp2	A	T	5: 65,807,565	T986S	probably damaging	Het
Naip6	C	A	13: 100,304,344		probably null	Het
Nphp4	G	A	4: 152,559,364	V1117M	probably benign	Het
Oca2	C	A	7: 56,297,137	Q305K	probably benign	Het
Olfr195	T	A	16: 59,148,885	F12I	probably damaging	Het
Olfr688	C	T	7: 105,288,503	Q137*	probably null	Het
Olfr845	G	A	9: 19,339,278	V273I	probably benign	Het
P2rx7	A	T	5: 122,644,095	N8Y	possibly damaging	Het
Pag1	A	T	3: 9,699,485	S203T	probably damaging	Het
Pfn4	T	A	12: 4,775,439		probably null	Het
Pip4k2c	T	C	10: 127,199,089	D414G	probably damaging	Het
Pkp1	T	G	1: 135,884,976	Q329P	possibly damaging	Het
Polrmt	A	T	10: 79,743,512	I135N	probably benign	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Ppp3cb	T	C	14: 20,508,678	T439A	possibly damaging	Het
Prkdc	A	G	16: 15,715,963	Y1555C	probably damaging	Het
Ptprh	T	C	7: 4,550,775	D859G	probably damaging	Het
Sema5a	T	A	15: 32,618,856	M510K	probably benign	Het
Slc22a16	A	G	10: 40,585,339	E379G	probably benign	Het
Slc30a5	C	A	13: 100,806,533		probably null	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tbc1d9	A	T	8: 83,270,987	S1058C	probably damaging	Het
Tet2	A	G	3: 133,485,727	L982P	possibly damaging	Het
Tmem101	G	T	11: 102,153,377	T228K	probably benign	Het
Tshz2	G	T	2: 169,886,215	K441N	probably damaging	Het
Upf1	A	T	8: 70,341,572	I228N	probably damaging	Het
Usp32	A	T	11: 85,030,512	I692N	probably damaging	Het
Vmn2r117	A	G	17: 23,460,256	S665P	possibly damaging	Het
Vps13b	T	C	15: 35,910,746	V3552A	possibly damaging	Het
Vps35	A	T	8: 85,263,465	M638K	possibly damaging	Het
Vps41	T	G	13: 18,852,351	I645S	probably benign	Het
Zfp703	T	C	8: 26,978,988	S227P	probably benign	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R0827:Hsp90aa1	UTSW	12	110692695	missense	probably benign	0.38
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R1498:Hsp90aa1	UTSW	12	110695688	splice site	probably null
R2039:Hsp90aa1	UTSW	12	110693782	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2393:Hsp90aa1	UTSW	12	110693406	missense	probably damaging	1.00
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2925:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4033:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5117:Hsp90aa1	UTSW	12	110695264	missense	possibly damaging	0.71
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7324:Hsp90aa1	UTSW	12	110695225	missense	unknown
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
R9004:Hsp90aa1	UTSW	12	110692611	missense	probably damaging	0.99
R9145:Hsp90aa1	UTSW	12	110696250	critical splice donor site	probably null
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGAGTGATGTGTAACCATTCACATAC -3'
(R):5'- CTCTACCTGTTGGACAGCAC -3'

Sequencing Primer
(F):5'- TGCAGAGGTTCTCAAATTTTGTC -3'
(R):5'- CTACCTGTTGGACAGCACTTAAGG -3'

Posted On

2014-09-18