Incidental Mutation 'R2082:Vps41'
ID230103
Institutional Source Beutler Lab
Gene Symbol Vps41
Ensembl Gene ENSMUSG00000041236
Gene NameVPS41 HOPS complex subunit
SynonymsVam2, mVam2
MMRRC Submission 040087-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2082 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location18717286-18866811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 18852351 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 645 (I645S)
Ref Sequence ENSEMBL: ENSMUSP00000072729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072961]
Predicted Effect probably benign
Transcript: ENSMUST00000072961
AA Change: I645S

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072729
Gene: ENSMUSG00000041236
AA Change: I645S

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Blast:WD40 34 70 2e-7 BLAST
SCOP:d1flga_ 44 253 6e-9 SMART
Blast:WD40 159 195 3e-11 BLAST
CLH 570 711 1.92e-42 SMART
RING 790 837 8.98e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die by E9 exhibiting morphological and functional alteration of late endocytic compartments, and abnormal triploblastic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,796,379 probably null Het
4933427I04Rik A G 4: 123,860,976 I228V probably benign Het
Aco2 T C 15: 81,913,695 W657R possibly damaging Het
Acsm2 T A 7: 119,580,634 H333Q probably benign Het
Adamts18 C T 8: 113,775,333 V299I probably damaging Het
Adat2 G A 10: 13,560,163 C84Y probably damaging Het
Arhgef11 C T 3: 87,725,996 T690I possibly damaging Het
Cachd1 A G 4: 101,002,958 D1242G probably damaging Het
Casp14 A G 10: 78,715,033 M106T probably benign Het
Ccdc69 T A 11: 55,052,389 I130F probably damaging Het
Cdk9 A G 2: 32,709,501 L189P probably damaging Het
Cfhr1 C T 1: 139,550,886 V249I possibly damaging Het
Chst1 T C 2: 92,613,990 V269A possibly damaging Het
Col18a1 G T 10: 77,059,293 P1178Q probably damaging Het
Col6a1 A G 10: 76,709,596 L1014P probably damaging Het
Crisp3 T C 17: 40,225,860 Y188C probably damaging Het
Dse G A 10: 34,155,940 R363C probably damaging Het
Exoc5 T C 14: 49,015,587 I525V probably benign Het
Fech A T 18: 64,458,189 I388N probably damaging Het
Fmnl1 T C 11: 103,192,025 L363P probably damaging Het
Gm10842 T A 11: 105,147,083 L64Q unknown Het
Gm8225 C A 17: 26,543,696 P287Q possibly damaging Het
Hsp90aa1 A T 12: 110,692,827 L512H probably damaging Het
Ifi30 T C 8: 70,763,728 probably benign Het
Iqsec1 A T 6: 90,694,574 D115E probably damaging Het
Kcnu1 T A 8: 25,921,549 L174H probably damaging Het
Krt10 A G 11: 99,388,875 V153A probably damaging Het
Krt18 G A 15: 102,031,020 probably null Het
Micu1 A G 10: 59,863,307 T469A probably benign Het
Mtss1l T C 8: 110,726,257 probably null Het
Myo10 T A 15: 25,785,993 F1253L probably damaging Het
N4bp2 A T 5: 65,807,565 T986S probably damaging Het
Naip6 C A 13: 100,304,344 probably null Het
Nphp4 G A 4: 152,559,364 V1117M probably benign Het
Oca2 C A 7: 56,297,137 Q305K probably benign Het
Olfr195 T A 16: 59,148,885 F12I probably damaging Het
Olfr688 C T 7: 105,288,503 Q137* probably null Het
Olfr845 G A 9: 19,339,278 V273I probably benign Het
P2rx7 A T 5: 122,644,095 N8Y possibly damaging Het
Pag1 A T 3: 9,699,485 S203T probably damaging Het
Pfn4 T A 12: 4,775,439 probably null Het
Pip4k2c T C 10: 127,199,089 D414G probably damaging Het
Pkp1 T G 1: 135,884,976 Q329P possibly damaging Het
Polrmt A T 10: 79,743,512 I135N probably benign Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Ppp3cb T C 14: 20,508,678 T439A possibly damaging Het
Prkdc A G 16: 15,715,963 Y1555C probably damaging Het
Ptprh T C 7: 4,550,775 D859G probably damaging Het
Sema5a T A 15: 32,618,856 M510K probably benign Het
Slc22a16 A G 10: 40,585,339 E379G probably benign Het
Slc30a5 C A 13: 100,806,533 probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tbc1d9 A T 8: 83,270,987 S1058C probably damaging Het
Tet2 A G 3: 133,485,727 L982P possibly damaging Het
Tmem101 G T 11: 102,153,377 T228K probably benign Het
Tshz2 G T 2: 169,886,215 K441N probably damaging Het
Upf1 A T 8: 70,341,572 I228N probably damaging Het
Usp32 A T 11: 85,030,512 I692N probably damaging Het
Vmn2r117 A G 17: 23,460,256 S665P possibly damaging Het
Vps13b T C 15: 35,910,746 V3552A possibly damaging Het
Vps35 A T 8: 85,263,465 M638K possibly damaging Het
Zfp703 T C 8: 26,978,988 S227P probably benign Het
Other mutations in Vps41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Vps41 APN 13 18866150 missense probably benign 0.37
IGL01563:Vps41 APN 13 18782727 splice site probably benign
IGL01880:Vps41 APN 13 18810471 missense probably benign 0.01
IGL02024:Vps41 APN 13 18791657 splice site probably benign
IGL02458:Vps41 APN 13 18853479 missense possibly damaging 0.67
IGL02740:Vps41 APN 13 18838680 missense probably damaging 1.00
IGL03218:Vps41 APN 13 18829270 missense possibly damaging 0.74
R0197:Vps41 UTSW 13 18854663 critical splice donor site probably null
R0284:Vps41 UTSW 13 18853440 missense probably damaging 1.00
R0321:Vps41 UTSW 13 18842295 splice site probably benign
R0372:Vps41 UTSW 13 18842247 missense probably benign 0.00
R0382:Vps41 UTSW 13 18827727 missense probably benign 0.30
R1691:Vps41 UTSW 13 18841243 missense probably damaging 1.00
R2055:Vps41 UTSW 13 18854616 missense possibly damaging 0.95
R2147:Vps41 UTSW 13 18839734 splice site probably null
R2897:Vps41 UTSW 13 18810428 splice site probably benign
R4322:Vps41 UTSW 13 18823790 missense probably damaging 1.00
R4600:Vps41 UTSW 13 18745283 missense probably damaging 0.97
R4751:Vps41 UTSW 13 18811622 missense probably damaging 0.98
R4856:Vps41 UTSW 13 18829255 missense probably damaging 0.98
R5389:Vps41 UTSW 13 18862538 missense probably damaging 0.99
R7022:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
R7456:Vps41 UTSW 13 18864034 missense probably benign 0.02
R7747:Vps41 UTSW 13 18841252 critical splice donor site probably null
R7790:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGGTCTGCAGAGATGTCCTTTG -3'
(R):5'- TTCCGACACATGGCTCCAAC -3'

Sequencing Primer
(F):5'- CTGCAGAGATGTCCTTTGTTTTGTTC -3'
(R):5'- ATGGCTCCAACAACTCTTGCTG -3'
Posted On2014-09-18