Mutagenetix > Incidental Mutation

Incidental Mutation 'R2082:Vmn2r117'

230115

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r117

Ensembl Gene

ENSMUSG00000091407

Gene Name

vomeronasal 2, receptor 117

Synonyms

EG619788

MMRRC Submission

040087-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R2082 (G1)

Quality Score

184

Status

Not validated

Chromosome

Chromosomal Location

23459675-23479597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23460256 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 665 (S665P)

Ref Sequence

ENSEMBL: ENSMUSP00000126885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171996]

AlphaFold

K7N6V1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171996
AA Change: S665P

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: S665P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.6e-28	PFAM
Pfam:NCD3G	512	565	5e-20	PFAM
Pfam:7tm_3	595	833	8.2e-54	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	A	2: 30,796,379		probably null	Het
4933427I04Rik	A	G	4: 123,860,976	I228V	probably benign	Het
Aco2	T	C	15: 81,913,695	W657R	possibly damaging	Het
Acsm2	T	A	7: 119,580,634	H333Q	probably benign	Het
Adamts18	C	T	8: 113,775,333	V299I	probably damaging	Het
Adat2	G	A	10: 13,560,163	C84Y	probably damaging	Het
Arhgef11	C	T	3: 87,725,996	T690I	possibly damaging	Het
Cachd1	A	G	4: 101,002,958	D1242G	probably damaging	Het
Casp14	A	G	10: 78,715,033	M106T	probably benign	Het
Ccdc69	T	A	11: 55,052,389	I130F	probably damaging	Het
Cdk9	A	G	2: 32,709,501	L189P	probably damaging	Het
Cfhr1	C	T	1: 139,550,886	V249I	possibly damaging	Het
Chst1	T	C	2: 92,613,990	V269A	possibly damaging	Het
Col18a1	G	T	10: 77,059,293	P1178Q	probably damaging	Het
Col6a1	A	G	10: 76,709,596	L1014P	probably damaging	Het
Crisp3	T	C	17: 40,225,860	Y188C	probably damaging	Het
Dse	G	A	10: 34,155,940	R363C	probably damaging	Het
Exoc5	T	C	14: 49,015,587	I525V	probably benign	Het
Fech	A	T	18: 64,458,189	I388N	probably damaging	Het
Fmnl1	T	C	11: 103,192,025	L363P	probably damaging	Het
Gm10842	T	A	11: 105,147,083	L64Q	unknown	Het
Gm8225	C	A	17: 26,543,696	P287Q	possibly damaging	Het
Hsp90aa1	A	T	12: 110,692,827	L512H	probably damaging	Het
Ifi30	T	C	8: 70,763,728		probably benign	Het
Iqsec1	A	T	6: 90,694,574	D115E	probably damaging	Het
Kcnu1	T	A	8: 25,921,549	L174H	probably damaging	Het
Krt10	A	G	11: 99,388,875	V153A	probably damaging	Het
Krt18	G	A	15: 102,031,020		probably null	Het
Micu1	A	G	10: 59,863,307	T469A	probably benign	Het
Mtss1l	T	C	8: 110,726,257		probably null	Het
Myo10	T	A	15: 25,785,993	F1253L	probably damaging	Het
N4bp2	A	T	5: 65,807,565	T986S	probably damaging	Het
Naip6	C	A	13: 100,304,344		probably null	Het
Nphp4	G	A	4: 152,559,364	V1117M	probably benign	Het
Oca2	C	A	7: 56,297,137	Q305K	probably benign	Het
Olfr195	T	A	16: 59,148,885	F12I	probably damaging	Het
Olfr688	C	T	7: 105,288,503	Q137*	probably null	Het
Olfr845	G	A	9: 19,339,278	V273I	probably benign	Het
P2rx7	A	T	5: 122,644,095	N8Y	possibly damaging	Het
Pag1	A	T	3: 9,699,485	S203T	probably damaging	Het
Pfn4	T	A	12: 4,775,439		probably null	Het
Pip4k2c	T	C	10: 127,199,089	D414G	probably damaging	Het
Pkp1	T	G	1: 135,884,976	Q329P	possibly damaging	Het
Polrmt	A	T	10: 79,743,512	I135N	probably benign	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Ppp3cb	T	C	14: 20,508,678	T439A	possibly damaging	Het
Prkdc	A	G	16: 15,715,963	Y1555C	probably damaging	Het
Ptprh	T	C	7: 4,550,775	D859G	probably damaging	Het
Sema5a	T	A	15: 32,618,856	M510K	probably benign	Het
Slc22a16	A	G	10: 40,585,339	E379G	probably benign	Het
Slc30a5	C	A	13: 100,806,533		probably null	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tbc1d9	A	T	8: 83,270,987	S1058C	probably damaging	Het
Tet2	A	G	3: 133,485,727	L982P	possibly damaging	Het
Tmem101	G	T	11: 102,153,377	T228K	probably benign	Het
Tshz2	G	T	2: 169,886,215	K441N	probably damaging	Het
Upf1	A	T	8: 70,341,572	I228N	probably damaging	Het
Usp32	A	T	11: 85,030,512	I692N	probably damaging	Het
Vps13b	T	C	15: 35,910,746	V3552A	possibly damaging	Het
Vps35	A	T	8: 85,263,465	M638K	possibly damaging	Het
Vps41	T	G	13: 18,852,351	I645S	probably benign	Het
Zfp703	T	C	8: 26,978,988	S227P	probably benign	Het

Other mutations in Vmn2r117

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r117	APN	17	23477840	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23475429	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23479546	missense	probably benign
IGL01078:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01139:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01374:Vmn2r117	APN	17	23478382	missense	possibly damaging	0.46
IGL01779:Vmn2r117	APN	17	23477241	missense	probably benign	0.00
IGL02283:Vmn2r117	APN	17	23475382	missense	probably damaging	0.99
IGL02527:Vmn2r117	APN	17	23477225	missense	possibly damaging	0.65
IGL02612:Vmn2r117	APN	17	23459784	missense	possibly damaging	0.91
IGL02887:Vmn2r117	APN	17	23475578	splice site	probably benign
IGL03167:Vmn2r117	APN	17	23477707	missense	probably damaging	1.00
R0315:Vmn2r117	UTSW	17	23460165	missense	probably benign	0.11
R0610:Vmn2r117	UTSW	17	23475514	missense	probably benign	0.00
R0747:Vmn2r117	UTSW	17	23475503	nonsense	probably null
R1411:Vmn2r117	UTSW	17	23460553	missense	probably damaging	1.00
R1471:Vmn2r117	UTSW	17	23478473	missense	probably benign	0.00
R1853:Vmn2r117	UTSW	17	23477455	missense	probably damaging	0.99
R1925:Vmn2r117	UTSW	17	23478389	missense	probably benign	0.00
R1940:Vmn2r117	UTSW	17	23477480	missense	probably damaging	1.00
R2005:Vmn2r117	UTSW	17	23477644	missense	probably damaging	1.00
R2698:Vmn2r117	UTSW	17	23459911	missense	probably damaging	0.98
R2972:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2973:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2974:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R3160:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3161:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3162:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3847:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R3848:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R4082:Vmn2r117	UTSW	17	23460106	missense	probably benign	0.00
R4320:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R4560:Vmn2r117	UTSW	17	23459877	missense	probably damaging	1.00
R4658:Vmn2r117	UTSW	17	23478416	missense	probably benign	0.01
R4881:Vmn2r117	UTSW	17	23477885	missense	probably damaging	1.00
R4908:Vmn2r117	UTSW	17	23459838	missense	probably damaging	1.00
R4910:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R5078:Vmn2r117	UTSW	17	23460148	missense	probably damaging	1.00
R5327:Vmn2r117	UTSW	17	23477874	nonsense	probably null
R5774:Vmn2r117	UTSW	17	23477202	missense	probably damaging	0.98
R6014:Vmn2r117	UTSW	17	23479561	missense	probably damaging	0.97
R6390:Vmn2r117	UTSW	17	23460114	missense	possibly damaging	0.95
R6520:Vmn2r117	UTSW	17	23460219	missense	probably damaging	0.99
R6674:Vmn2r117	UTSW	17	23460049	nonsense	probably null
R6736:Vmn2r117	UTSW	17	23478308	missense	probably damaging	0.99
R6909:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
R6913:Vmn2r117	UTSW	17	23479563	missense	probably damaging	0.99
R7220:Vmn2r117	UTSW	17	23477203	missense	probably damaging	1.00
R7260:Vmn2r117	UTSW	17	23475385	missense	probably benign	0.06
R7440:Vmn2r117	UTSW	17	23475565	missense	probably benign	0.26
R7443:Vmn2r117	UTSW	17	23460133	missense	probably benign	0.25
R7443:Vmn2r117	UTSW	17	23460345	missense	probably damaging	1.00
R7449:Vmn2r117	UTSW	17	23459895	missense	probably damaging	1.00
R7644:Vmn2r117	UTSW	17	23477291	missense	probably damaging	0.98
R7914:Vmn2r117	UTSW	17	23460126	missense	possibly damaging	0.95
R8001:Vmn2r117	UTSW	17	23479407	missense	possibly damaging	0.89
R8029:Vmn2r117	UTSW	17	23477770	missense	probably benign	0.00
R8340:Vmn2r117	UTSW	17	23460537	missense	probably benign	0.01
R8519:Vmn2r117	UTSW	17	23479468	missense	probably benign
R8723:Vmn2r117	UTSW	17	23477369	missense	probably damaging	1.00
R8914:Vmn2r117	UTSW	17	23460169	missense	probably benign	0.02
R9010:Vmn2r117	UTSW	17	23460471	missense	probably benign	0.10
R9129:Vmn2r117	UTSW	17	23459944	nonsense	probably null
R9244:Vmn2r117	UTSW	17	23477615	missense	probably damaging	0.98
R9464:Vmn2r117	UTSW	17	23477604	missense	probably benign	0.23
R9620:Vmn2r117	UTSW	17	23478476	missense	probably damaging	0.97
V5622:Vmn2r117	UTSW	17	23477840	missense	probably damaging	1.00
V5622:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
Z1176:Vmn2r117	UTSW	17	23459766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCCTTGTGGCATACGATG -3'
(R):5'- GTGAAGCACCACAGTACTCC -3'

Sequencing Primer
(F):5'- GCATACGATGATGATCTGTCCATGC -3'
(R):5'- CAGTACTCCAATTGTTAAGGCC -3'

Posted On

2014-09-18