Mutagenetix > Incidental Mutation

Incidental Mutation 'R2083:Ptpn4'

230122

Institutional Source

Beutler Lab

Gene Symbol

Ptpn4

Ensembl Gene

ENSMUSG00000026384

Gene Name

protein tyrosine phosphatase, non-receptor type 4

Synonyms

TEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)

MMRRC Submission

040088-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.314) question?

Stock #

R2083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119652467-119837613 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119687759 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 555 (L555P)

Ref Sequence

ENSEMBL: ENSMUSP00000067614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000163435] [ENSMUST00000166624]

AlphaFold

Q9WU22

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064091
AA Change: L555P

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: L555P

Domain	Start	End	E-Value	Type
B41	25	222	7.33e-80	SMART
FERM_C	226	316	6.48e-34	SMART
FA	322	368	3.28e-12	SMART
PDZ	526	605	2.47e-14	SMART
PTPc	654	913	1.38e-120	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163435

SMART Domains

Protein: ENSMUSP00000127713
Gene: ENSMUSG00000026384

Domain	Start	End	E-Value	Type
B41	25	222	7.33e-80	SMART
FERM_C	226	316	6.48e-34	SMART
FA	322	368	3.28e-12	SMART
PDB:3NFL\|D	499	552	4e-30	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000166624

SMART Domains

Protein: ENSMUSP00000126216
Gene: ENSMUSG00000026384

Domain	Start	End	E-Value	Type
Blast:PTPc	1	65	1e-34	BLAST
PDB:2I75\|A	15	67	2e-28	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	T	A	5: 146,184,871	M73L	possibly damaging	Het
AA986860	A	T	1: 130,741,069	I58F	probably damaging	Het
Acsl3	A	T	1: 78,699,811	K507N	probably damaging	Het
Adcy3	T	C	12: 4,173,512	Y245H	probably damaging	Het
Adgra1	T	C	7: 139,875,631	S392P	probably damaging	Het
Ahnak	C	T	19: 9,011,557	P3402S	probably damaging	Het
Ambra1	T	A	2: 91,766,600	I12N	possibly damaging	Het
Atp10b	A	G	11: 43,212,423	T545A	probably benign	Het
Atxn2	G	T	5: 121,784,006	A638S	probably benign	Het
Cd109	T	C	9: 78,667,293	S520P	probably damaging	Het
Col6a3	T	C	1: 90,782,011	D1821G	unknown	Het
Cyp4a10	T	C	4: 115,525,308	V265A	possibly damaging	Het
Dmrtb1	C	T	4: 107,683,612	R184Q	possibly damaging	Het
Dnah7b	A	T	1: 46,241,067	I2719F	possibly damaging	Het
En2	T	C	5: 28,167,073	S183P	probably damaging	Het
Etfb	A	G	7: 43,456,500	T101A	probably benign	Het
Etl4	T	A	2: 20,743,549	S364T	probably damaging	Het
Fam196b	A	G	11: 34,402,141	D61G	probably benign	Het
Gm17728	C	A	17: 9,422,289	S77Y	possibly damaging	Het
Golga4	A	G	9: 118,532,590	E221G	probably damaging	Het
Gpr37	T	C	6: 25,688,417	N227S	possibly damaging	Het
Kctd1	A	T	18: 14,974,055	N784K	possibly damaging	Het
Klhl22	A	G	16: 17,776,525	T173A	probably benign	Het
Ly6e	T	A	15: 74,958,319	C41S	probably damaging	Het
Mapkbp1	T	C	2: 120,015,482	L444P	possibly damaging	Het
Mkx	A	T	18: 6,992,855	I143K	probably damaging	Het
Mlh3	A	G	12: 85,269,041	F124L	probably benign	Het
Nlrp1a	A	T	11: 71,124,220	L68H	possibly damaging	Het
Obscn	A	C	11: 59,073,631	Y726*	probably null	Het
Olfr1312	C	T	2: 112,042,553	V160I	probably benign	Het
Olfr26	T	G	9: 38,855,341	V93G	probably benign	Het
Peak1	G	A	9: 56,258,949	S565L	probably damaging	Het
Pter	T	A	2: 12,978,436	L84Q	probably damaging	Het
Rpp40	A	T	13: 35,898,992	M171K	probably benign	Het
Sacs	A	G	14: 61,206,506	I2000M	possibly damaging	Het
Scn5a	T	C	9: 119,492,123	I1458V	probably benign	Het
Slc38a4	T	C	15: 97,008,993	D288G	probably benign	Het
Slc8a2	T	G	7: 16,134,515	V224G	probably damaging	Het
Sptbn4	T	C	7: 27,428,256	E173G	probably benign	Het
Tas1r1	T	A	4: 152,028,391	H735L	probably benign	Het
Trps1	G	T	15: 50,822,305	Q155K	probably damaging	Het
Tspyl5	T	C	15: 33,686,746	H351R	probably damaging	Het
Ttf2	A	T	3: 100,969,501	D21E	probably benign	Het
Ttll7	A	G	3: 146,930,104	R398G	possibly damaging	Het
Tubgcp6	A	T	15: 89,122,376	Y148N	probably damaging	Het
Vmn1r8	T	A	6: 57,036,340	H125Q	probably benign	Het
Zfhx4	A	G	3: 5,403,163	T2794A	possibly damaging	Het
Zfp27	T	C	7: 29,894,783	I586V	probably benign	Het
Zfyve16	T	C	13: 92,524,262	D13G	probably damaging	Het

Other mutations in Ptpn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Ptpn4	APN	1	119659925	splice site	probably benign
IGL00885:Ptpn4	APN	1	119802363	missense	possibly damaging	0.95
IGL00973:Ptpn4	APN	1	119741371	missense	probably benign	0.00
IGL01867:Ptpn4	APN	1	119675599	missense	probably benign
IGL01870:Ptpn4	APN	1	119675547	critical splice donor site	probably null
IGL02101:Ptpn4	APN	1	119687678	missense	probably damaging	1.00
IGL02344:Ptpn4	APN	1	119773260	missense	probably damaging	1.00
IGL02348:Ptpn4	APN	1	119682722	missense	probably damaging	1.00
IGL02693:Ptpn4	APN	1	119715969	missense	probably damaging	0.96
IGL03281:Ptpn4	APN	1	119659912	missense	probably damaging	1.00
alto	UTSW	1	119684581	nonsense	probably null
blinding	UTSW	1	119721862	critical splice donor site	probably null
botched	UTSW	1	119743390	missense	probably damaging	1.00
bungled	UTSW	1	119687605	splice site	probably null
Fovea	UTSW	1	119678822	missense	possibly damaging	0.81
hash	UTSW	1	119765919	nonsense	probably null
Hoechter	UTSW	1	119680059	missense	probably damaging	1.00
Lumens	UTSW	1	119667548	missense	probably damaging	1.00
BB008:Ptpn4	UTSW	1	119680195	missense	probably damaging	0.98
BB018:Ptpn4	UTSW	1	119680195	missense	probably damaging	0.98
R0105:Ptpn4	UTSW	1	119687605	splice site	probably null
R0105:Ptpn4	UTSW	1	119687605	splice site	probably null
R0504:Ptpn4	UTSW	1	119765915	missense	probably damaging	1.00
R1148:Ptpn4	UTSW	1	119684540	missense	probably damaging	0.99
R1148:Ptpn4	UTSW	1	119675709	splice site	probably benign
R1148:Ptpn4	UTSW	1	119684540	missense	probably damaging	0.99
R1662:Ptpn4	UTSW	1	119765058	missense	probably damaging	0.96
R1694:Ptpn4	UTSW	1	119783510	missense	probably damaging	0.99
R1733:Ptpn4	UTSW	1	119716043	splice site	probably null
R2226:Ptpn4	UTSW	1	119682785	missense	probably damaging	1.00
R2276:Ptpn4	UTSW	1	119684591	missense	probably damaging	1.00
R2277:Ptpn4	UTSW	1	119684591	missense	probably damaging	1.00
R3123:Ptpn4	UTSW	1	119765423	splice site	probably null
R3425:Ptpn4	UTSW	1	119707830	missense	probably benign	0.02
R4568:Ptpn4	UTSW	1	119680059	missense	probably damaging	1.00
R4716:Ptpn4	UTSW	1	119721868	missense	probably damaging	1.00
R4819:Ptpn4	UTSW	1	119659850	missense	probably benign
R4959:Ptpn4	UTSW	1	119765096	nonsense	probably null
R5161:Ptpn4	UTSW	1	119707863	nonsense	probably null
R5345:Ptpn4	UTSW	1	119765477	missense	probably benign
R5471:Ptpn4	UTSW	1	119765919	nonsense	probably null
R5826:Ptpn4	UTSW	1	119684516	missense	probably benign	0.32
R5933:Ptpn4	UTSW	1	119687723	missense	probably damaging	0.97
R6075:Ptpn4	UTSW	1	119765136	missense	probably damaging	1.00
R6286:Ptpn4	UTSW	1	119721862	critical splice donor site	probably null
R6389:Ptpn4	UTSW	1	119721954	missense	probably damaging	0.97
R6392:Ptpn4	UTSW	1	119773123	missense	probably benign
R6769:Ptpn4	UTSW	1	119715968	missense	probably benign	0.01
R6771:Ptpn4	UTSW	1	119715968	missense	probably benign	0.01
R6794:Ptpn4	UTSW	1	119743390	missense	probably damaging	1.00
R6933:Ptpn4	UTSW	1	119773148	intron	probably benign
R6967:Ptpn4	UTSW	1	119684581	nonsense	probably null
R6980:Ptpn4	UTSW	1	119743421	missense	possibly damaging	0.86
R7150:Ptpn4	UTSW	1	119691745	critical splice donor site	probably null
R7247:Ptpn4	UTSW	1	119690034	makesense	probably null
R7283:Ptpn4	UTSW	1	119682531	missense	possibly damaging	0.90
R7459:Ptpn4	UTSW	1	119659834	missense	probably damaging	0.99
R7732:Ptpn4	UTSW	1	119692802	missense	probably benign
R7794:Ptpn4	UTSW	1	119726037	missense	probably damaging	1.00
R8061:Ptpn4	UTSW	1	119691600	critical splice donor site	probably null
R8236:Ptpn4	UTSW	1	119678822	missense	possibly damaging	0.81
R8929:Ptpn4	UTSW	1	119667548	missense	probably damaging	1.00
R8979:Ptpn4	UTSW	1	119743390	missense	probably damaging	1.00
R9334:Ptpn4	UTSW	1	119802384	missense	probably benign
RF014:Ptpn4	UTSW	1	119684465	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCGTGTCCAGGAGTAAACAGC -3'
(R):5'- GAATCTTTCTGGACATAATAGGCCA -3'

Sequencing Primer
(F):5'- GGACAAATCCTCAGTGCTACACAG -3'
(R):5'- GAACTAGAGGCTGATGACTTCCTC -3'

Posted On

2014-09-18