Incidental Mutation 'R2083:Pter'
ID230126
Institutional Source Beutler Lab
Gene Symbol Pter
Ensembl Gene ENSMUSG00000026730
Gene Namephosphotriesterase related
SynonymsMpr56-1
MMRRC Submission 040088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R2083 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location12924041-13003455 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12978436 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 84 (L84Q)
Ref Sequence ENSEMBL: ENSMUSP00000118645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028063] [ENSMUST00000114796] [ENSMUST00000134794] [ENSMUST00000154269]
Predicted Effect probably damaging
Transcript: ENSMUST00000028063
AA Change: L84Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028063
Gene: ENSMUSG00000026730
AA Change: L84Q

DomainStartEndE-ValueType
Pfam:PTE 15 260 1.8e-105 PFAM
Pfam:TatD_DNase 66 252 3.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114796
SMART Domains Protein: ENSMUSP00000110444
Gene: ENSMUSG00000026730

DomainStartEndE-ValueType
Pfam:PTE 15 62 1.9e-13 PFAM
Pfam:PTE 52 253 4.6e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134794
AA Change: L84Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117009
Gene: ENSMUSG00000026730
AA Change: L84Q

DomainStartEndE-ValueType
Pfam:PTE 15 347 1e-153 PFAM
Pfam:TatD_DNase 67 300 1.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150283
Predicted Effect probably damaging
Transcript: ENSMUST00000154269
AA Change: L84Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118645
Gene: ENSMUSG00000026730
AA Change: L84Q

DomainStartEndE-ValueType
Pfam:PTE 15 181 1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195521
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,184,871 M73L possibly damaging Het
AA986860 A T 1: 130,741,069 I58F probably damaging Het
Acsl3 A T 1: 78,699,811 K507N probably damaging Het
Adcy3 T C 12: 4,173,512 Y245H probably damaging Het
Adgra1 T C 7: 139,875,631 S392P probably damaging Het
Ahnak C T 19: 9,011,557 P3402S probably damaging Het
Ambra1 T A 2: 91,766,600 I12N possibly damaging Het
Atp10b A G 11: 43,212,423 T545A probably benign Het
Atxn2 G T 5: 121,784,006 A638S probably benign Het
Cd109 T C 9: 78,667,293 S520P probably damaging Het
Col6a3 T C 1: 90,782,011 D1821G unknown Het
Cyp4a10 T C 4: 115,525,308 V265A possibly damaging Het
Dmrtb1 C T 4: 107,683,612 R184Q possibly damaging Het
Dnah7b A T 1: 46,241,067 I2719F possibly damaging Het
En2 T C 5: 28,167,073 S183P probably damaging Het
Etfb A G 7: 43,456,500 T101A probably benign Het
Etl4 T A 2: 20,743,549 S364T probably damaging Het
Fam196b A G 11: 34,402,141 D61G probably benign Het
Gm17728 C A 17: 9,422,289 S77Y possibly damaging Het
Golga4 A G 9: 118,532,590 E221G probably damaging Het
Gpr37 T C 6: 25,688,417 N227S possibly damaging Het
Kctd1 A T 18: 14,974,055 N784K possibly damaging Het
Klhl22 A G 16: 17,776,525 T173A probably benign Het
Ly6e T A 15: 74,958,319 C41S probably damaging Het
Mapkbp1 T C 2: 120,015,482 L444P possibly damaging Het
Mkx A T 18: 6,992,855 I143K probably damaging Het
Mlh3 A G 12: 85,269,041 F124L probably benign Het
Nlrp1a A T 11: 71,124,220 L68H possibly damaging Het
Obscn A C 11: 59,073,631 Y726* probably null Het
Olfr1312 C T 2: 112,042,553 V160I probably benign Het
Olfr26 T G 9: 38,855,341 V93G probably benign Het
Peak1 G A 9: 56,258,949 S565L probably damaging Het
Ptpn4 A G 1: 119,687,759 L555P possibly damaging Het
Rpp40 A T 13: 35,898,992 M171K probably benign Het
Sacs A G 14: 61,206,506 I2000M possibly damaging Het
Scn5a T C 9: 119,492,123 I1458V probably benign Het
Slc38a4 T C 15: 97,008,993 D288G probably benign Het
Slc8a2 T G 7: 16,134,515 V224G probably damaging Het
Sptbn4 T C 7: 27,428,256 E173G probably benign Het
Tas1r1 T A 4: 152,028,391 H735L probably benign Het
Trps1 G T 15: 50,822,305 Q155K probably damaging Het
Tspyl5 T C 15: 33,686,746 H351R probably damaging Het
Ttf2 A T 3: 100,969,501 D21E probably benign Het
Ttll7 A G 3: 146,930,104 R398G possibly damaging Het
Tubgcp6 A T 15: 89,122,376 Y148N probably damaging Het
Vmn1r8 T A 6: 57,036,340 H125Q probably benign Het
Zfhx4 A G 3: 5,403,163 T2794A possibly damaging Het
Zfp27 T C 7: 29,894,783 I586V probably benign Het
Zfyve16 T C 13: 92,524,262 D13G probably damaging Het
Other mutations in Pter
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4812001:Pter UTSW 2 12980368 missense probably damaging 0.97
R0015:Pter UTSW 2 13001000 missense probably damaging 1.00
R0015:Pter UTSW 2 13001000 missense probably damaging 1.00
R0325:Pter UTSW 2 13000937 missense probably damaging 1.00
R0383:Pter UTSW 2 13000942 nonsense probably null
R1452:Pter UTSW 2 12978621 splice site probably benign
R1538:Pter UTSW 2 12978606 missense probably benign 0.02
R1699:Pter UTSW 2 12994761 missense probably damaging 0.97
R3437:Pter UTSW 2 13000994 missense probably benign 0.01
R5707:Pter UTSW 2 12978180 utr 5 prime probably benign
R6267:Pter UTSW 2 12978541 missense probably damaging 1.00
R6298:Pter UTSW 2 12978394 missense probably damaging 1.00
R6329:Pter UTSW 2 12980548 missense probably damaging 1.00
R7842:Pter UTSW 2 12978541 missense probably damaging 1.00
R7894:Pter UTSW 2 12994755 missense probably damaging 0.99
R8218:Pter UTSW 2 12980555 missense probably damaging 1.00
R8415:Pter UTSW 2 13000889 missense probably damaging 1.00
R8813:Pter UTSW 2 12980303 missense probably benign 0.32
R8862:Pter UTSW 2 12980530 missense probably damaging 1.00
Z1177:Pter UTSW 2 13000941 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAGTTCTGGGCCTTGTAGAAC -3'
(R):5'- CACTGACATGGCTCTGGTTG -3'

Sequencing Primer
(F):5'- TGGGCCTTGTAGAACCCAGC -3'
(R):5'- GCTGCAGAGTGAGTTGCATCAAC -3'
Posted On2014-09-18