Incidental Mutation 'R2083:Etl4'
ID 230127
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Name enhancer trap locus 4
Synonyms 6620402G01Rik, Sickle tail, E330027G05Rik, Etl-4, Skt, 9430077C05Rik
MMRRC Submission 040088-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.809) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 19915018-20815346 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20748360 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 364 (S364T)
Ref Sequence ENSEMBL: ENSMUSP00000110274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114606] [ENSMUST00000114607] [ENSMUST00000114608] [ENSMUST00000114610] [ENSMUST00000114614] [ENSMUST00000114627]
AlphaFold A2AQ25
Predicted Effect probably damaging
Transcript: ENSMUST00000045555
AA Change: S313T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: S313T

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066509
AA Change: S313T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: S313T

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114604
AA Change: S313T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: S313T

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114606
AA Change: S31T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110253
Gene: ENSMUSG00000036617
AA Change: S31T

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114607
AA Change: S31T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110254
Gene: ENSMUSG00000036617
AA Change: S31T

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114608
AA Change: S31T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110255
Gene: ENSMUSG00000036617
AA Change: S31T

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 1055 1064 N/A INTRINSIC
low complexity region 1153 1178 N/A INTRINSIC
low complexity region 1254 1265 N/A INTRINSIC
coiled coil region 1341 1369 N/A INTRINSIC
low complexity region 1407 1420 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114610
AA Change: S233T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110257
Gene: ENSMUSG00000036617
AA Change: S233T

DomainStartEndE-ValueType
Pfam:AIP3 108 211 5e-12 PFAM
low complexity region 233 248 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114614
AA Change: S313T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: S313T

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114627
AA Change: S364T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: S364T

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125556
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,121,681 (GRCm39) M73L possibly damaging Het
AA986860 A T 1: 130,668,806 (GRCm39) I58F probably damaging Het
Acsl3 A T 1: 78,677,528 (GRCm39) K507N probably damaging Het
Adcy3 T C 12: 4,223,512 (GRCm39) Y245H probably damaging Het
Adgra1 T C 7: 139,455,547 (GRCm39) S392P probably damaging Het
Ahnak C T 19: 8,988,921 (GRCm39) P3402S probably damaging Het
Ambra1 T A 2: 91,596,945 (GRCm39) I12N possibly damaging Het
Atp10b A G 11: 43,103,250 (GRCm39) T545A probably benign Het
Atxn2 G T 5: 121,922,069 (GRCm39) A638S probably benign Het
Cd109 T C 9: 78,574,575 (GRCm39) S520P probably damaging Het
Col6a3 T C 1: 90,709,733 (GRCm39) D1821G unknown Het
Cyp4a10 T C 4: 115,382,505 (GRCm39) V265A possibly damaging Het
Dmrtb1 C T 4: 107,540,809 (GRCm39) R184Q possibly damaging Het
Dnah7b A T 1: 46,280,227 (GRCm39) I2719F possibly damaging Het
En2 T C 5: 28,372,071 (GRCm39) S183P probably damaging Het
Etfb A G 7: 43,105,924 (GRCm39) T101A probably benign Het
Gm17728 C A 17: 9,641,121 (GRCm39) S77Y possibly damaging Het
Golga4 A G 9: 118,361,658 (GRCm39) E221G probably damaging Het
Gpr37 T C 6: 25,688,416 (GRCm39) N227S possibly damaging Het
Insyn2b A G 11: 34,352,141 (GRCm39) D61G probably benign Het
Kctd1 A T 18: 15,107,112 (GRCm39) N784K possibly damaging Het
Klhl22 A G 16: 17,594,389 (GRCm39) T173A probably benign Het
Ly6e T A 15: 74,830,168 (GRCm39) C41S probably damaging Het
Mapkbp1 T C 2: 119,845,963 (GRCm39) L444P possibly damaging Het
Mkx A T 18: 6,992,855 (GRCm39) I143K probably damaging Het
Mlh3 A G 12: 85,315,815 (GRCm39) F124L probably benign Het
Nlrp1a A T 11: 71,015,046 (GRCm39) L68H possibly damaging Het
Obscn A C 11: 58,964,457 (GRCm39) Y726* probably null Het
Or4f59 C T 2: 111,872,898 (GRCm39) V160I probably benign Het
Or8d1 T G 9: 38,766,637 (GRCm39) V93G probably benign Het
Peak1 G A 9: 56,166,233 (GRCm39) S565L probably damaging Het
Pter T A 2: 12,983,247 (GRCm39) L84Q probably damaging Het
Ptpn4 A G 1: 119,615,489 (GRCm39) L555P possibly damaging Het
Rpp40 A T 13: 36,082,975 (GRCm39) M171K probably benign Het
Sacs A G 14: 61,443,955 (GRCm39) I2000M possibly damaging Het
Scn5a T C 9: 119,321,189 (GRCm39) I1458V probably benign Het
Slc38a4 T C 15: 96,906,874 (GRCm39) D288G probably benign Het
Slc8a2 T G 7: 15,868,440 (GRCm39) V224G probably damaging Het
Sptbn4 T C 7: 27,127,681 (GRCm39) E173G probably benign Het
Tas1r1 T A 4: 152,112,848 (GRCm39) H735L probably benign Het
Trps1 G T 15: 50,685,701 (GRCm39) Q155K probably damaging Het
Tspyl5 T C 15: 33,686,892 (GRCm39) H351R probably damaging Het
Ttf2 A T 3: 100,876,817 (GRCm39) D21E probably benign Het
Ttll7 A G 3: 146,635,859 (GRCm39) R398G possibly damaging Het
Tubgcp6 A T 15: 89,006,579 (GRCm39) Y148N probably damaging Het
Vmn1r8 T A 6: 57,013,325 (GRCm39) H125Q probably benign Het
Zfhx4 A G 3: 5,468,223 (GRCm39) T2794A possibly damaging Het
Zfp27 T C 7: 29,594,208 (GRCm39) I586V probably benign Het
Zfyve16 T C 13: 92,660,770 (GRCm39) D13G probably damaging Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20,771,289 (GRCm39) missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20,534,865 (GRCm39) missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20,811,342 (GRCm39) nonsense probably null
IGL01099:Etl4 APN 2 20,811,922 (GRCm39) missense probably benign 0.06
IGL01337:Etl4 APN 2 20,790,198 (GRCm39) missense probably benign 0.01
IGL01348:Etl4 APN 2 20,811,784 (GRCm39) missense probably damaging 1.00
IGL01349:Etl4 APN 2 20,718,207 (GRCm39) missense probably damaging 1.00
IGL01407:Etl4 APN 2 20,748,667 (GRCm39) missense probably damaging 0.99
IGL01552:Etl4 APN 2 20,783,000 (GRCm39) missense probably damaging 0.99
IGL01662:Etl4 APN 2 20,811,460 (GRCm39) missense probably benign 0.04
IGL01687:Etl4 APN 2 20,534,898 (GRCm39) missense probably damaging 1.00
IGL01793:Etl4 APN 2 20,748,709 (GRCm39) missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20,811,493 (GRCm39) missense probably benign 0.06
IGL02025:Etl4 APN 2 20,811,337 (GRCm39) missense probably damaging 1.00
IGL02088:Etl4 APN 2 20,811,359 (GRCm39) missense probably damaging 1.00
IGL02134:Etl4 APN 2 20,811,240 (GRCm39) missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20,535,000 (GRCm39) missense probably damaging 1.00
IGL02480:Etl4 APN 2 20,793,335 (GRCm39) missense probably damaging 0.99
IGL02560:Etl4 APN 2 20,748,529 (GRCm39) missense probably damaging 1.00
IGL02851:Etl4 APN 2 20,812,840 (GRCm39) missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20,765,021 (GRCm39) splice site probably benign
IGL02951:Etl4 APN 2 20,806,348 (GRCm39) splice site probably benign
IGL03119:Etl4 APN 2 20,718,198 (GRCm39) missense probably damaging 1.00
IGL03267:Etl4 APN 2 20,789,993 (GRCm39) nonsense probably null
IGL03379:Etl4 APN 2 20,666,827 (GRCm39) missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20,748,385 (GRCm39) missense probably damaging 1.00
R0038:Etl4 UTSW 2 20,748,385 (GRCm39) missense probably damaging 1.00
R0095:Etl4 UTSW 2 20,748,679 (GRCm39) missense probably damaging 1.00
R0100:Etl4 UTSW 2 20,344,716 (GRCm39) missense probably benign
R0311:Etl4 UTSW 2 20,811,940 (GRCm39) missense probably damaging 1.00
R0346:Etl4 UTSW 2 20,764,463 (GRCm39) critical splice donor site probably null
R0348:Etl4 UTSW 2 20,782,940 (GRCm39) missense probably damaging 1.00
R0379:Etl4 UTSW 2 20,812,165 (GRCm39) missense probably damaging 0.98
R0571:Etl4 UTSW 2 20,748,580 (GRCm39) missense probably damaging 0.99
R0697:Etl4 UTSW 2 20,748,672 (GRCm39) missense probably damaging 1.00
R0707:Etl4 UTSW 2 20,810,382 (GRCm39) splice site probably benign
R0980:Etl4 UTSW 2 20,806,378 (GRCm39) missense probably damaging 1.00
R1120:Etl4 UTSW 2 20,811,514 (GRCm39) missense probably benign 0.00
R1254:Etl4 UTSW 2 20,812,734 (GRCm39) missense probably damaging 1.00
R1346:Etl4 UTSW 2 20,810,955 (GRCm39) missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20,793,288 (GRCm39) missense probably damaging 1.00
R1503:Etl4 UTSW 2 20,748,685 (GRCm39) missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20,790,039 (GRCm39) missense probably damaging 1.00
R1627:Etl4 UTSW 2 20,806,390 (GRCm39) missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20,811,219 (GRCm39) missense probably damaging 1.00
R1716:Etl4 UTSW 2 20,748,492 (GRCm39) missense probably damaging 1.00
R1795:Etl4 UTSW 2 20,812,837 (GRCm39) critical splice donor site probably null
R1885:Etl4 UTSW 2 20,748,795 (GRCm39) missense probably damaging 1.00
R2039:Etl4 UTSW 2 20,790,039 (GRCm39) missense probably damaging 1.00
R2109:Etl4 UTSW 2 20,790,153 (GRCm39) missense probably benign 0.27
R2153:Etl4 UTSW 2 20,803,545 (GRCm39) missense probably benign 0.00
R2403:Etl4 UTSW 2 20,812,117 (GRCm39) nonsense probably null
R2883:Etl4 UTSW 2 20,810,985 (GRCm39) missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20,786,660 (GRCm39) missense probably damaging 1.00
R3402:Etl4 UTSW 2 20,786,693 (GRCm39) missense probably damaging 1.00
R3696:Etl4 UTSW 2 20,806,473 (GRCm39) critical splice donor site probably null
R3755:Etl4 UTSW 2 20,748,348 (GRCm39) missense probably benign 0.10
R3813:Etl4 UTSW 2 20,793,246 (GRCm39) missense probably damaging 1.00
R3829:Etl4 UTSW 2 20,790,232 (GRCm39) missense probably benign 0.07
R3887:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3888:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3889:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3958:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R3959:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R3960:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R4058:Etl4 UTSW 2 20,810,830 (GRCm39) missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20,814,030 (GRCm39) utr 3 prime probably benign
R4077:Etl4 UTSW 2 20,812,772 (GRCm39) missense probably damaging 1.00
R4078:Etl4 UTSW 2 20,812,772 (GRCm39) missense probably damaging 1.00
R4127:Etl4 UTSW 2 20,748,886 (GRCm39) missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20,786,694 (GRCm39) missense probably damaging 1.00
R4492:Etl4 UTSW 2 20,811,676 (GRCm39) missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20,666,709 (GRCm39) missense probably damaging 1.00
R4820:Etl4 UTSW 2 20,811,496 (GRCm39) missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20,811,738 (GRCm39) missense probably damaging 1.00
R4888:Etl4 UTSW 2 20,344,922 (GRCm39) critical splice donor site probably null
R4938:Etl4 UTSW 2 20,803,460 (GRCm39) missense probably benign 0.00
R4943:Etl4 UTSW 2 20,812,092 (GRCm39) missense probably benign 0.05
R5121:Etl4 UTSW 2 20,344,922 (GRCm39) critical splice donor site probably null
R5191:Etl4 UTSW 2 20,344,810 (GRCm39) missense probably damaging 0.99
R5198:Etl4 UTSW 2 20,718,198 (GRCm39) missense probably damaging 1.00
R5199:Etl4 UTSW 2 20,748,853 (GRCm39) missense probably damaging 1.00
R5470:Etl4 UTSW 2 20,534,791 (GRCm39) missense probably damaging 0.99
R5513:Etl4 UTSW 2 20,748,638 (GRCm39) missense probably damaging 1.00
R5620:Etl4 UTSW 2 20,535,037 (GRCm39) missense probably damaging 1.00
R5635:Etl4 UTSW 2 20,811,846 (GRCm39) missense probably damaging 1.00
R5641:Etl4 UTSW 2 20,811,273 (GRCm39) frame shift probably null
R5690:Etl4 UTSW 2 20,810,647 (GRCm39) missense probably benign 0.01
R5784:Etl4 UTSW 2 20,811,016 (GRCm39) missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20,811,323 (GRCm39) missense probably damaging 1.00
R5908:Etl4 UTSW 2 20,748,718 (GRCm39) missense probably damaging 0.96
R5982:Etl4 UTSW 2 20,785,826 (GRCm39) missense probably damaging 1.00
R6151:Etl4 UTSW 2 20,718,171 (GRCm39) missense probably damaging 1.00
R6192:Etl4 UTSW 2 20,806,362 (GRCm39) missense probably damaging 0.98
R6238:Etl4 UTSW 2 20,806,379 (GRCm39) missense probably damaging 1.00
R6248:Etl4 UTSW 2 20,813,900 (GRCm39) missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20,748,384 (GRCm39) missense probably damaging 1.00
R6610:Etl4 UTSW 2 20,718,180 (GRCm39) missense probably damaging 1.00
R6739:Etl4 UTSW 2 20,718,246 (GRCm39) missense probably damaging 1.00
R6846:Etl4 UTSW 2 20,748,919 (GRCm39) missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20,811,120 (GRCm39) missense probably benign 0.01
R6873:Etl4 UTSW 2 20,802,803 (GRCm39) splice site probably null
R7003:Etl4 UTSW 2 20,810,695 (GRCm39) missense probably benign 0.03
R7155:Etl4 UTSW 2 20,811,742 (GRCm39) missense probably damaging 0.96
R7207:Etl4 UTSW 2 20,714,387 (GRCm39) missense probably damaging 0.99
R7230:Etl4 UTSW 2 20,802,799 (GRCm39) missense probably damaging 1.00
R7305:Etl4 UTSW 2 20,714,368 (GRCm39) missense probably damaging 1.00
R7389:Etl4 UTSW 2 20,789,904 (GRCm39) nonsense probably null
R7396:Etl4 UTSW 2 20,803,449 (GRCm39) missense possibly damaging 0.62
R7441:Etl4 UTSW 2 20,749,000 (GRCm39) missense possibly damaging 0.87
R7626:Etl4 UTSW 2 20,718,189 (GRCm39) missense probably damaging 1.00
R7776:Etl4 UTSW 2 20,811,957 (GRCm39) missense probably damaging 0.99
R7779:Etl4 UTSW 2 20,714,288 (GRCm39) missense probably damaging 1.00
R7798:Etl4 UTSW 2 20,786,757 (GRCm39) critical splice donor site probably null
R7851:Etl4 UTSW 2 20,748,951 (GRCm39) missense probably damaging 1.00
R7861:Etl4 UTSW 2 20,810,721 (GRCm39) missense probably benign
R7901:Etl4 UTSW 2 20,294,821 (GRCm39) missense possibly damaging 0.83
R8053:Etl4 UTSW 2 20,666,774 (GRCm39) missense probably damaging 1.00
R8124:Etl4 UTSW 2 20,811,451 (GRCm39) missense probably benign 0.06
R8133:Etl4 UTSW 2 20,811,082 (GRCm39) missense possibly damaging 0.86
R8203:Etl4 UTSW 2 20,789,916 (GRCm39) missense possibly damaging 0.61
R8238:Etl4 UTSW 2 20,811,342 (GRCm39) nonsense probably null
R8263:Etl4 UTSW 2 20,748,965 (GRCm39) missense probably benign 0.00
R8299:Etl4 UTSW 2 20,748,874 (GRCm39) missense possibly damaging 0.81
R8318:Etl4 UTSW 2 20,793,341 (GRCm39) missense probably damaging 1.00
R8334:Etl4 UTSW 2 20,785,857 (GRCm39) missense probably damaging 0.96
R8443:Etl4 UTSW 2 20,810,977 (GRCm39) missense probably benign 0.04
R8525:Etl4 UTSW 2 20,534,892 (GRCm39) missense probably damaging 1.00
R8679:Etl4 UTSW 2 20,714,288 (GRCm39) missense probably damaging 1.00
R8918:Etl4 UTSW 2 20,811,246 (GRCm39) missense probably benign 0.00
R8918:Etl4 UTSW 2 20,748,733 (GRCm39) missense probably benign
R9062:Etl4 UTSW 2 20,748,616 (GRCm39) missense probably damaging 0.99
R9095:Etl4 UTSW 2 20,782,964 (GRCm39) missense probably damaging 1.00
R9200:Etl4 UTSW 2 20,786,702 (GRCm39) missense probably damaging 1.00
R9416:Etl4 UTSW 2 20,748,784 (GRCm39) missense probably benign 0.17
R9437:Etl4 UTSW 2 20,813,872 (GRCm39) missense probably benign 0.20
R9451:Etl4 UTSW 2 20,813,926 (GRCm39) missense probably benign 0.03
R9489:Etl4 UTSW 2 20,771,345 (GRCm39) missense possibly damaging 0.75
R9531:Etl4 UTSW 2 20,294,818 (GRCm39) start codon destroyed probably null 0.01
R9605:Etl4 UTSW 2 20,771,345 (GRCm39) missense possibly damaging 0.75
R9623:Etl4 UTSW 2 20,811,052 (GRCm39) missense
R9631:Etl4 UTSW 2 20,666,749 (GRCm39) missense probably benign 0.28
R9632:Etl4 UTSW 2 20,666,749 (GRCm39) missense probably benign 0.28
R9646:Etl4 UTSW 2 20,802,724 (GRCm39) missense probably benign 0.00
R9732:Etl4 UTSW 2 20,748,373 (GRCm39) missense probably damaging 0.98
R9755:Etl4 UTSW 2 20,790,048 (GRCm39) missense probably benign 0.17
R9771:Etl4 UTSW 2 20,811,537 (GRCm39) missense probably benign
RF003:Etl4 UTSW 2 20,524,729 (GRCm39) nonsense probably null
X0018:Etl4 UTSW 2 20,814,001 (GRCm39) missense probably damaging 0.98
X0022:Etl4 UTSW 2 20,714,375 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTCACCTTGTCACATGAG -3'
(R):5'- GTCGGCATAGAAACCCTCATTTC -3'

Sequencing Primer
(F):5'- ATTCACCTTGTCACATGAGACCCC -3'
(R):5'- GAACATAACCAGGTTTTTGCTGCTC -3'
Posted On 2014-09-18