Mutagenetix > Incidental Mutations

Incidental Mutation 'R2083:Ambra1'

230128

Institutional Source

Beutler Lab

Gene Symbol

Ambra1

Ensembl Gene

ENSMUSG00000040506

Gene Name

autophagy/beclin 1 regulator 1

Synonyms

2310079H06Rik, D030051N19Rik

MMRRC Submission

040088-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.861) question?

Stock #

R2083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91730134-91918849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 91766600 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 12 (I12N)

Ref Sequence

ENSEMBL: ENSMUSP00000106949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045699] [ENSMUST00000045705] [ENSMUST00000099712] [ENSMUST00000111316] [ENSMUST00000111317]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045699
AA Change: I12N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048898
Gene: ENSMUSG00000040506
AA Change: I12N

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
low complexity region	636	643	N/A	INTRINSIC
Blast:WD40	812	850	1e-5	BLAST
Blast:WD40	871	918	1e-7	BLAST
low complexity region	942	954	N/A	INTRINSIC
low complexity region	1002	1026	N/A	INTRINSIC
low complexity region	1127	1143	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045705
AA Change: I12N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000049258
Gene: ENSMUSG00000040506
AA Change: I12N

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	267	285	N/A	INTRINSIC
low complexity region	442	452	N/A	INTRINSIC
low complexity region	484	495	N/A	INTRINSIC
low complexity region	629	645	N/A	INTRINSIC
low complexity region	682	704	N/A	INTRINSIC
low complexity region	756	763	N/A	INTRINSIC
Blast:WD40	932	970	1e-5	BLAST
Blast:WD40	991	1038	1e-7	BLAST
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1122	1146	N/A	INTRINSIC
low complexity region	1247	1263	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099712
AA Change: I12N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097299
Gene: ENSMUSG00000040506
AA Change: I12N

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	613	N/A	INTRINSIC
low complexity region	665	672	N/A	INTRINSIC
Blast:WD40	841	879	1e-5	BLAST
Blast:WD40	900	947	1e-7	BLAST
low complexity region	971	983	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
low complexity region	1156	1172	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111316
AA Change: I12N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000106948
Gene: ENSMUSG00000040506
AA Change: I12N

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	267	285	N/A	INTRINSIC
low complexity region	442	452	N/A	INTRINSIC
low complexity region	484	495	N/A	INTRINSIC
low complexity region	629	645	N/A	INTRINSIC
low complexity region	682	704	N/A	INTRINSIC
Blast:WD40	872	910	1e-5	BLAST
Blast:WD40	931	978	1e-7	BLAST
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1062	1086	N/A	INTRINSIC
low complexity region	1187	1203	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111317
AA Change: I12N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000106949
Gene: ENSMUSG00000040506
AA Change: I12N

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
low complexity region	636	643	N/A	INTRINSIC
Blast:WD40	812	850	1e-5	BLAST
Blast:WD40	871	918	1e-7	BLAST
low complexity region	942	954	N/A	INTRINSIC
low complexity region	1002	1026	N/A	INTRINSIC
low complexity region	1127	1143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124132

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156496

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Most mice homozygous for a gene trap mutation die at E10-E14.5 with severe neural tube defects manifest as midbrain/hindbrain exencephaly and/or spina bifida and associated with impaired autophagy, accumulation of ubiquitinated proteins, abnormal cell proliferation and excessive apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	T	A	5: 146,184,871	M73L	possibly damaging	Het
AA986860	A	T	1: 130,741,069	I58F	probably damaging	Het
Acsl3	A	T	1: 78,699,811	K507N	probably damaging	Het
Adcy3	T	C	12: 4,173,512	Y245H	probably damaging	Het
Adgra1	T	C	7: 139,875,631	S392P	probably damaging	Het
Ahnak	C	T	19: 9,011,557	P3402S	probably damaging	Het
Atp10b	A	G	11: 43,212,423	T545A	probably benign	Het
Atxn2	G	T	5: 121,784,006	A638S	probably benign	Het
Cd109	T	C	9: 78,667,293	S520P	probably damaging	Het
Col6a3	T	C	1: 90,782,011	D1821G	unknown	Het
Cyp4a10	T	C	4: 115,525,308	V265A	possibly damaging	Het
Dmrtb1	C	T	4: 107,683,612	R184Q	possibly damaging	Het
Dnah7b	A	T	1: 46,241,067	I2719F	possibly damaging	Het
En2	T	C	5: 28,167,073	S183P	probably damaging	Het
Etfb	A	G	7: 43,456,500	T101A	probably benign	Het
Etl4	T	A	2: 20,743,549	S364T	probably damaging	Het
Fam196b	A	G	11: 34,402,141	D61G	probably benign	Het
Gm17728	C	A	17: 9,422,289	S77Y	possibly damaging	Het
Golga4	A	G	9: 118,532,590	E221G	probably damaging	Het
Gpr37	T	C	6: 25,688,417	N227S	possibly damaging	Het
Kctd1	A	T	18: 14,974,055	N784K	possibly damaging	Het
Klhl22	A	G	16: 17,776,525	T173A	probably benign	Het
Ly6e	T	A	15: 74,958,319	C41S	probably damaging	Het
Mapkbp1	T	C	2: 120,015,482	L444P	possibly damaging	Het
Mkx	A	T	18: 6,992,855	I143K	probably damaging	Het
Mlh3	A	G	12: 85,269,041	F124L	probably benign	Het
Nlrp1a	A	T	11: 71,124,220	L68H	possibly damaging	Het
Obscn	A	C	11: 59,073,631	Y726*	probably null	Het
Olfr1312	C	T	2: 112,042,553	V160I	probably benign	Het
Olfr26	T	G	9: 38,855,341	V93G	probably benign	Het
Peak1	G	A	9: 56,258,949	S565L	probably damaging	Het
Pter	T	A	2: 12,978,436	L84Q	probably damaging	Het
Ptpn4	A	G	1: 119,687,759	L555P	possibly damaging	Het
Rpp40	A	T	13: 35,898,992	M171K	probably benign	Het
Sacs	A	G	14: 61,206,506	I2000M	possibly damaging	Het
Scn5a	T	C	9: 119,492,123	I1458V	probably benign	Het
Slc38a4	T	C	15: 97,008,993	D288G	probably benign	Het
Slc8a2	T	G	7: 16,134,515	V224G	probably damaging	Het
Sptbn4	T	C	7: 27,428,256	E173G	probably benign	Het
Tas1r1	T	A	4: 152,028,391	H735L	probably benign	Het
Trps1	G	T	15: 50,822,305	Q155K	probably damaging	Het
Tspyl5	T	C	15: 33,686,746	H351R	probably damaging	Het
Ttf2	A	T	3: 100,969,501	D21E	probably benign	Het
Ttll7	A	G	3: 146,930,104	R398G	possibly damaging	Het
Tubgcp6	A	T	15: 89,122,376	Y148N	probably damaging	Het
Vmn1r8	T	A	6: 57,036,340	H125Q	probably benign	Het
Zfhx4	A	G	3: 5,403,163	T2794A	possibly damaging	Het
Zfp27	T	C	7: 29,894,783	I586V	probably benign	Het
Zfyve16	T	C	13: 92,524,262	D13G	probably damaging	Het

Other mutations in Ambra1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Ambra1	APN	2	91911589	missense	probably benign	0.01
IGL00861:Ambra1	APN	2	91770926	missense	possibly damaging	0.81
IGL00911:Ambra1	APN	2	91767682	splice site	probably benign
IGL01371:Ambra1	APN	2	91825286	missense	probably damaging	1.00
IGL01532:Ambra1	APN	2	91885632	missense	probably damaging	1.00
IGL01620:Ambra1	APN	2	91911412	critical splice acceptor site	probably null
IGL02147:Ambra1	APN	2	91767719	missense	probably benign	0.01
IGL02170:Ambra1	APN	2	91767087	missense	possibly damaging	0.66
IGL02173:Ambra1	APN	2	91917668	missense	probably benign
IGL02212:Ambra1	APN	2	91917361	missense	probably damaging	1.00
IGL02256:Ambra1	APN	2	91769054	missense	possibly damaging	0.95
IGL02319:Ambra1	APN	2	91886920	missense	probably damaging	1.00
IGL02502:Ambra1	APN	2	91900532	missense	probably damaging	1.00
IGL02961:Ambra1	APN	2	91911448	missense	possibly damaging	0.86
R0003:Ambra1	UTSW	2	91911428	missense	probably damaging	1.00
R0098:Ambra1	UTSW	2	91767711	missense	possibly damaging	0.66
R0173:Ambra1	UTSW	2	91810219	splice site	probably benign
R0414:Ambra1	UTSW	2	91875739	missense	possibly damaging	0.84
R0579:Ambra1	UTSW	2	91824465	missense	possibly damaging	0.66
R1212:Ambra1	UTSW	2	91769036	missense	possibly damaging	0.94
R1241:Ambra1	UTSW	2	91770896	splice site	probably benign
R1467:Ambra1	UTSW	2	91885703	missense	probably damaging	1.00
R1467:Ambra1	UTSW	2	91885703	missense	probably damaging	1.00
R1533:Ambra1	UTSW	2	91886865	missense	probably damaging	1.00
R1916:Ambra1	UTSW	2	91911461	missense	probably damaging	1.00
R2080:Ambra1	UTSW	2	91885719	missense	probably damaging	1.00
R2112:Ambra1	UTSW	2	91875787	missense	probably damaging	1.00
R2255:Ambra1	UTSW	2	91917461	missense	probably damaging	1.00
R3407:Ambra1	UTSW	2	91910307	missense	probably damaging	1.00
R3732:Ambra1	UTSW	2	91810131	missense	probably damaging	1.00
R4111:Ambra1	UTSW	2	91900558	missense	probably damaging	1.00
R4792:Ambra1	UTSW	2	91772846	missense	possibly damaging	0.66
R4879:Ambra1	UTSW	2	91772694	intron	probably benign
R5007:Ambra1	UTSW	2	91772310	missense	possibly damaging	0.79
R5261:Ambra1	UTSW	2	91885606	missense	probably damaging	1.00
R6141:Ambra1	UTSW	2	91875754	missense	probably damaging	1.00
R6364:Ambra1	UTSW	2	91773316	missense	possibly damaging	0.66
R6413:Ambra1	UTSW	2	91769084	missense	possibly damaging	0.92
R6868:Ambra1	UTSW	2	91917533	missense	possibly damaging	0.83
R6888:Ambra1	UTSW	2	91769027	missense	probably damaging	1.00
R6964:Ambra1	UTSW	2	91917416	nonsense	probably null
R6970:Ambra1	UTSW	2	91772600	intron	probably benign
R6982:Ambra1	UTSW	2	91917473	missense	probably damaging	1.00
R7205:Ambra1	UTSW	2	91767758	missense	possibly damaging	0.46
R7458:Ambra1	UTSW	2	91917684	missense	probably benign	0.26
R7786:Ambra1	UTSW	2	91767796	missense	possibly damaging	0.46
R7812:Ambra1	UTSW	2	91766566	start codon destroyed	probably benign	0.00
R7825:Ambra1	UTSW	2	91767761	missense	probably damaging	1.00
R7860:Ambra1	UTSW	2	91773493	missense	probably benign	0.27
R8190:Ambra1	UTSW	2	91772352	missense	possibly damaging	0.95
R8779:Ambra1	UTSW	2	91917374	missense	probably benign	0.05
Z1177:Ambra1	UTSW	2	91768999	missense	possibly damaging	0.81
Z1177:Ambra1	UTSW	2	91875786	missense	probably damaging	0.97
Z1177:Ambra1	UTSW	2	91900608	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GGAGCCTCTCTGGTGTAGAATAGG -3'
(R):5'- GCTATATCAAGTCTCAGGGACAAG -3'

Sequencing Primer
(F):5'- CTGGTGTAGAATAGGCATTATTTGAC -3'
(R):5'- CTCCACAAATCCTAGGTCA -3'

Posted On

2014-09-18