Mutagenetix > Incidental Mutations

Incidental Mutation 'R0179:Lct'

23013

Institutional Source

Beutler Lab

Gene Symbol

Lct

Ensembl Gene

ENSMUSG00000026354

Gene Name

lactase

Synonyms

LPH, LOC226413, Lphl

MMRRC Submission

038447-MU

Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0179 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

128284756-128328318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 128327685 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 207 (V207I)

Ref Sequence

ENSEMBL: ENSMUSP00000073190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000073490] [ENSMUST00000190495]

Predicted Effect

probably benign
Transcript: ENSMUST00000027601

SMART Domains

Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	821	1e-47	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000073490
AA Change: V207I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: V207I

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	76	226	1.6e-19	PFAM
low complexity region	322	340	N/A	INTRINSIC
Pfam:Glyco_hydro_1	380	849	4.8e-169	PFAM
low complexity region	865	875	N/A	INTRINSIC
Pfam:Glyco_hydro_1	902	1368	3.7e-181	PFAM
Pfam:Glyco_hydro_1	1377	1844	6.9e-183	PFAM
transmembrane domain	1885	1907	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190495

SMART Domains

Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	783	3e-29	PDB

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,972,214	S516P	probably benign	Het
4932431P20Rik	A	G	7: 29,535,940		noncoding transcript	Het
Adamts1	C	T	16: 85,795,465	S948N	probably benign	Het
Adck1	A	T	12: 88,459,172	M457L	possibly damaging	Het
Adprm	A	T	11: 67,038,225	H313Q	possibly damaging	Het
Adssl1	T	C	12: 112,632,269	I104T	probably benign	Het
Agxt2	A	C	15: 10,399,048	Q435P	possibly damaging	Het
Amotl1	G	A	9: 14,548,773	A890V	probably benign	Het
Ankrd50	A	G	3: 38,455,314	V968A	possibly damaging	Het
Brf2	T	C	8: 27,125,868	D163G	possibly damaging	Het
Cd226	C	A	18: 89,207,139	N53K	probably benign	Het
Cdc42ep2	T	C	19: 5,918,608	D23G	probably benign	Het
Cdc7	T	C	5: 106,965,039	S8P	probably benign	Het
Cdh8	C	T	8: 99,111,712	E499K	possibly damaging	Het
Chd7	T	A	4: 8,862,516	F2534L	probably benign	Het
Ckb	T	C	12: 111,670,176	T255A	probably benign	Het
Cntnap5c	G	T	17: 57,769,625	W19L	probably benign	Het
Cntrl	A	G	2: 35,167,859	E1854G	probably benign	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cop1	A	G	1: 159,250,066	D157G	probably benign	Het
Csf2rb	A	C	15: 78,336,372	Q38P	possibly damaging	Het
Ctla2b	T	C	13: 60,896,293	D52G	possibly damaging	Het
Dcaf7	A	T	11: 106,051,797	D190V	probably damaging	Het
Depdc5	T	A	5: 32,901,574		probably benign	Het
Dgkq	A	G	5: 108,658,200		probably benign	Het
Dhrs2	A	G	14: 55,240,476	T222A	probably damaging	Het
Dock1	G	A	7: 135,098,837	D1109N	probably damaging	Het
E4f1	G	C	17: 24,451,437	T92S	possibly damaging	Het
Ep400	A	T	5: 110,668,649	S2669T	probably damaging	Het
Eprs	T	G	1: 185,413,547	D1184E	probably benign	Het
Fpr-rs4	A	T	17: 18,022,027	K99*	probably null	Het
Fzr1	A	T	10: 81,369,070		probably benign	Het
Gcc2	C	T	10: 58,276,650	R1001C	probably benign	Het
Gm4884	A	G	7: 41,043,828	D407G	probably benign	Het
Golga4	A	T	9: 118,560,740		probably null	Het
Gp2	T	G	7: 119,452,317	D225A	possibly damaging	Het
Gramd1a	T	A	7: 31,142,418	T120S	probably damaging	Het
Hbb-bh2	T	A	7: 103,839,227	N121I	probably benign	Het
Htr6	A	T	4: 139,062,126	L276Q	probably damaging	Het
Itga9	A	T	9: 118,661,386	I262F	probably benign	Het
Lamc3	A	G	2: 31,915,084		probably benign	Het
Large1	T	C	8: 73,098,846	N200S	probably benign	Het
Marf1	C	A	16: 14,151,176	L144F	probably damaging	Het
Morc2b	A	T	17: 33,136,982	Y605*	probably null	Het
Mtus1	G	T	8: 41,002,361	L87I	possibly damaging	Het
Muc2	A	G	7: 141,748,971	Y17C	probably damaging	Het
Myf5	T	C	10: 107,485,918	D5G	possibly damaging	Het
Nasp	C	T	4: 116,602,157	V375M	probably damaging	Het
Nr1h2	A	T	7: 44,552,265		probably null	Het
Nrg2	T	C	18: 36,022,415	Q447R	probably benign	Het
Ntn5	G	A	7: 45,686,313	G56D	probably damaging	Het
Oasl2	A	G	5: 114,910,912	R138G	probably benign	Het
Olfr1209	A	T	2: 88,909,893	C167S	possibly damaging	Het
Olfr1489	T	A	19: 13,633,140	F10I	probably damaging	Het
Olfr827	T	C	10: 130,210,338	Y264C	probably damaging	Het
Pcdhb5	G	A	18: 37,322,559	G664D	probably damaging	Het
Ppp1r15a	T	C	7: 45,525,000	E128G	probably damaging	Het
Prpf19	T	C	19: 10,897,808		probably benign	Het
Ptpn3	T	A	4: 57,270,118	T15S	probably benign	Het
R3hdm2	G	A	10: 127,495,106	C818Y	probably damaging	Het
Rad51d	A	G	11: 82,889,998	V39A	possibly damaging	Het
Rptor	A	T	11: 119,872,367	T926S	probably benign	Het
Rwdd4a	G	A	8: 47,542,707	D41N	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Ssbp3	T	C	4: 107,046,388	S334P	probably damaging	Het
Suco	A	G	1: 161,876,305		probably benign	Het
Synj1	T	C	16: 90,964,631	K649R	possibly damaging	Het
Tdp2	C	T	13: 24,840,448	H243Y	possibly damaging	Het
Tinag	A	G	9: 76,996,882		probably benign	Het
Trerf1	T	C	17: 47,316,662		noncoding transcript	Het
Trip10	T	C	17: 57,262,349		probably benign	Het
Tsen54	A	T	11: 115,822,030	S131C	probably damaging	Het
Unc5c	A	T	3: 141,818,067	R794*	probably null	Het
Vmn2r59	A	T	7: 42,047,008	Y103*	probably null	Het
Washc5	A	G	15: 59,352,530	V460A	probably benign	Het
Whamm	A	G	7: 81,594,015	T358A	probably benign	Het
Xlr4b	C	T	X: 73,218,671		probably benign	Het
Zbbx	C	T	3: 75,085,562		probably benign	Het
Zdhhc23	G	A	16: 43,973,703	P203S	probably benign	Het
Zfp27	T	A	7: 29,896,425	E38D	possibly damaging	Het

Other mutations in Lct

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Lct	APN	1	128287556	missense	probably benign	0.09
IGL00970:Lct	APN	1	128304068	missense	probably damaging	1.00
IGL01022:Lct	APN	1	128300859	missense	probably benign
IGL01878:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL01892:Lct	APN	1	128307605	missense	probably damaging	1.00
IGL02307:Lct	APN	1	128286590	missense	possibly damaging	0.70
IGL02434:Lct	APN	1	128303790	missense	probably damaging	0.97
IGL02559:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL02623:Lct	APN	1	128308251	missense	probably benign	0.01
IGL02818:Lct	APN	1	128300168	missense	probably damaging	1.00
IGL02949:Lct	APN	1	128313132	missense	probably benign	0.26
IGL02951:Lct	APN	1	128300211	missense	probably damaging	1.00
IGL03087:Lct	APN	1	128300375	missense	possibly damaging	0.81
IGL03227:Lct	APN	1	128327689	missense	probably benign	0.09
ANU18:Lct	UTSW	1	128308047	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0135:Lct	UTSW	1	128285123	missense	probably damaging	0.98
R0145:Lct	UTSW	1	128327895	missense	probably benign	0.00
R0331:Lct	UTSW	1	128298742	splice site	probably benign
R0366:Lct	UTSW	1	128286462	missense	probably benign	0.03
R0399:Lct	UTSW	1	128300525	missense	probably damaging	1.00
R0492:Lct	UTSW	1	128300582	missense	probably damaging	1.00
R0548:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R0691:Lct	UTSW	1	128308234	missense	probably benign	0.00
R0755:Lct	UTSW	1	128294135	missense	possibly damaging	0.46
R0839:Lct	UTSW	1	128286609	missense	probably benign	0.00
R1128:Lct	UTSW	1	128301309	missense	probably damaging	0.99
R1135:Lct	UTSW	1	128294124	critical splice donor site	probably null
R1321:Lct	UTSW	1	128300022	missense	probably benign
R1448:Lct	UTSW	1	128307822	missense	probably damaging	0.99
R1450:Lct	UTSW	1	128307903	missense	probably damaging	1.00
R1572:Lct	UTSW	1	128294195	missense	probably benign	0.25
R1582:Lct	UTSW	1	128300562	missense	probably damaging	1.00
R1668:Lct	UTSW	1	128287722	splice site	probably null
R1757:Lct	UTSW	1	128301257	missense	probably damaging	1.00
R1775:Lct	UTSW	1	128300301	missense	probably damaging	1.00
R1792:Lct	UTSW	1	128327942	missense	possibly damaging	0.54
R1815:Lct	UTSW	1	128300159	missense	probably damaging	1.00
R1932:Lct	UTSW	1	128294161	missense	probably damaging	1.00
R2325:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R2381:Lct	UTSW	1	128304121	nonsense	probably null
R3001:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3002:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3003:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3011:Lct	UTSW	1	128301372	missense	possibly damaging	0.74
R3082:Lct	UTSW	1	128287608	missense	probably damaging	1.00
R3683:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3684:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3726:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3886:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3887:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3888:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4019:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4027:Lct	UTSW	1	128285181	missense	probably benign	0.00
R4226:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4409:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4514:Lct	UTSW	1	128300514	missense	probably benign
R4570:Lct	UTSW	1	128299904	missense	probably benign	0.01
R4776:Lct	UTSW	1	128300387	missense	probably damaging	0.99
R5001:Lct	UTSW	1	128308241	missense	probably damaging	0.96
R5021:Lct	UTSW	1	128300565	missense	probably benign	0.38
R5318:Lct	UTSW	1	128304372	missense	probably damaging	1.00
R5330:Lct	UTSW	1	128298529	missense	probably benign	0.06
R5385:Lct	UTSW	1	128311617	missense	possibly damaging	0.63
R5499:Lct	UTSW	1	128286677	missense	probably damaging	1.00
R5508:Lct	UTSW	1	128294131	missense	probably damaging	1.00
R5642:Lct	UTSW	1	128295232	missense	probably damaging	1.00
R5724:Lct	UTSW	1	128300336	missense	probably benign
R6026:Lct	UTSW	1	128300018	missense	probably benign
R6044:Lct	UTSW	1	128307980	missense	possibly damaging	0.95
R6175:Lct	UTSW	1	128327714	missense	probably damaging	1.00
R6277:Lct	UTSW	1	128304237	missense	probably benign	0.01
R6412:Lct	UTSW	1	128327718	missense	probably benign	0.00
R6480:Lct	UTSW	1	128294320	missense	probably damaging	1.00
R6526:Lct	UTSW	1	128300478	missense	probably benign	0.05
R6620:Lct	UTSW	1	128295072	critical splice donor site	probably null
R7214:Lct	UTSW	1	128300460	missense	probably benign	0.00
R7308:Lct	UTSW	1	128319087	missense	probably benign	0.00
R7577:Lct	UTSW	1	128300732	missense	probably damaging	0.99
R7626:Lct	UTSW	1	128285195	missense	probably damaging	1.00
X0052:Lct	UTSW	1	128307630	missense	probably damaging	1.00
YA93:Lct	UTSW	1	128301320	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATGTTTCAGACAAATGCAGGACACA -3'
(R):5'- AGCAGTGCAGTGCTACCGACAA -3'

Sequencing Primer
(F):5'- ATTTGTGTCCCCTTTGGAAATG -3'
(R):5'- TGAAGGATGCCCAGCTTCAG -3'

Posted On

2013-04-16