Incidental Mutation 'R2083:Mapkbp1'
ID 230130
Institutional Source Beutler Lab
Gene Symbol Mapkbp1
Ensembl Gene ENSMUSG00000033902
Gene Name mitogen-activated protein kinase binding protein 1
Synonyms 2810483F24Rik, Jnkbp1
MMRRC Submission 040088-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 119972699-120027408 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120015482 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 444 (L444P)
Ref Sequence ENSEMBL: ENSMUSP00000155163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066058] [ENSMUST00000229024]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000066058
AA Change: L438P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068516
Gene: ENSMUSG00000033902
AA Change: L438P

DomainStartEndE-ValueType
WD40 80 121 8.75e-5 SMART
WD40 124 165 3.64e-2 SMART
WD40 168 205 4.62e-1 SMART
low complexity region 220 234 N/A INTRINSIC
WD40 264 301 2.65e1 SMART
WD40 332 367 1.99e0 SMART
WD40 374 422 1.29e-2 SMART
WD40 463 502 3.9e-2 SMART
WD40 505 547 2.77e-1 SMART
WD40 551 592 2.67e-1 SMART
WD40 599 639 2.21e1 SMART
WD40 642 684 5.75e-1 SMART
WD40 687 726 6.04e-8 SMART
low complexity region 736 747 N/A INTRINSIC
low complexity region 779 795 N/A INTRINSIC
low complexity region 1028 1054 N/A INTRINSIC
coiled coil region 1400 1427 N/A INTRINSIC
low complexity region 1460 1477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184907
Predicted Effect possibly damaging
Transcript: ENSMUST00000229024
AA Change: L444P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,184,871 M73L possibly damaging Het
AA986860 A T 1: 130,741,069 I58F probably damaging Het
Acsl3 A T 1: 78,699,811 K507N probably damaging Het
Adcy3 T C 12: 4,173,512 Y245H probably damaging Het
Adgra1 T C 7: 139,875,631 S392P probably damaging Het
Ahnak C T 19: 9,011,557 P3402S probably damaging Het
Ambra1 T A 2: 91,766,600 I12N possibly damaging Het
Atp10b A G 11: 43,212,423 T545A probably benign Het
Atxn2 G T 5: 121,784,006 A638S probably benign Het
Cd109 T C 9: 78,667,293 S520P probably damaging Het
Col6a3 T C 1: 90,782,011 D1821G unknown Het
Cyp4a10 T C 4: 115,525,308 V265A possibly damaging Het
Dmrtb1 C T 4: 107,683,612 R184Q possibly damaging Het
Dnah7b A T 1: 46,241,067 I2719F possibly damaging Het
En2 T C 5: 28,167,073 S183P probably damaging Het
Etfb A G 7: 43,456,500 T101A probably benign Het
Etl4 T A 2: 20,743,549 S364T probably damaging Het
Fam196b A G 11: 34,402,141 D61G probably benign Het
Gm17728 C A 17: 9,422,289 S77Y possibly damaging Het
Golga4 A G 9: 118,532,590 E221G probably damaging Het
Gpr37 T C 6: 25,688,417 N227S possibly damaging Het
Kctd1 A T 18: 14,974,055 N784K possibly damaging Het
Klhl22 A G 16: 17,776,525 T173A probably benign Het
Ly6e T A 15: 74,958,319 C41S probably damaging Het
Mkx A T 18: 6,992,855 I143K probably damaging Het
Mlh3 A G 12: 85,269,041 F124L probably benign Het
Nlrp1a A T 11: 71,124,220 L68H possibly damaging Het
Obscn A C 11: 59,073,631 Y726* probably null Het
Olfr1312 C T 2: 112,042,553 V160I probably benign Het
Olfr26 T G 9: 38,855,341 V93G probably benign Het
Peak1 G A 9: 56,258,949 S565L probably damaging Het
Pter T A 2: 12,978,436 L84Q probably damaging Het
Ptpn4 A G 1: 119,687,759 L555P possibly damaging Het
Rpp40 A T 13: 35,898,992 M171K probably benign Het
Sacs A G 14: 61,206,506 I2000M possibly damaging Het
Scn5a T C 9: 119,492,123 I1458V probably benign Het
Slc38a4 T C 15: 97,008,993 D288G probably benign Het
Slc8a2 T G 7: 16,134,515 V224G probably damaging Het
Sptbn4 T C 7: 27,428,256 E173G probably benign Het
Tas1r1 T A 4: 152,028,391 H735L probably benign Het
Trps1 G T 15: 50,822,305 Q155K probably damaging Het
Tspyl5 T C 15: 33,686,746 H351R probably damaging Het
Ttf2 A T 3: 100,969,501 D21E probably benign Het
Ttll7 A G 3: 146,930,104 R398G possibly damaging Het
Tubgcp6 A T 15: 89,122,376 Y148N probably damaging Het
Vmn1r8 T A 6: 57,036,340 H125Q probably benign Het
Zfhx4 A G 3: 5,403,163 T2794A possibly damaging Het
Zfp27 T C 7: 29,894,783 I586V probably benign Het
Zfyve16 T C 13: 92,524,262 D13G probably damaging Het
Other mutations in Mapkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mapkbp1 APN 2 120021858 missense possibly damaging 0.94
IGL01309:Mapkbp1 APN 2 120018942 missense probably damaging 1.00
IGL01728:Mapkbp1 APN 2 120023821 missense probably damaging 1.00
IGL01808:Mapkbp1 APN 2 120023169 splice site probably null
IGL02185:Mapkbp1 APN 2 120014663 missense possibly damaging 0.58
IGL02421:Mapkbp1 APN 2 120019655 missense possibly damaging 0.95
IGL02691:Mapkbp1 APN 2 119973174 splice site probably benign
IGL03146:Mapkbp1 APN 2 119998474 splice site probably benign
IGL03387:Mapkbp1 APN 2 119998498 missense probably damaging 0.99
IGL03054:Mapkbp1 UTSW 2 120015400 missense probably damaging 0.97
R0118:Mapkbp1 UTSW 2 120025215 missense probably benign 0.00
R0393:Mapkbp1 UTSW 2 120012903 splice site probably null
R0463:Mapkbp1 UTSW 2 120023151 missense probably benign 0.01
R0788:Mapkbp1 UTSW 2 120024001 missense probably benign 0.02
R0928:Mapkbp1 UTSW 2 120015368 missense probably benign 0.00
R1104:Mapkbp1 UTSW 2 120011073 splice site probably benign
R1162:Mapkbp1 UTSW 2 120025318 missense possibly damaging 0.87
R1219:Mapkbp1 UTSW 2 120019350 nonsense probably null
R1299:Mapkbp1 UTSW 2 120015404 missense probably damaging 1.00
R1300:Mapkbp1 UTSW 2 120013655 missense probably benign 0.25
R1342:Mapkbp1 UTSW 2 119998534 missense possibly damaging 0.95
R1456:Mapkbp1 UTSW 2 119973145 missense probably damaging 1.00
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1660:Mapkbp1 UTSW 2 120018548 missense possibly damaging 0.83
R2008:Mapkbp1 UTSW 2 120012665 missense probably damaging 1.00
R2371:Mapkbp1 UTSW 2 120010780 missense probably damaging 1.00
R2423:Mapkbp1 UTSW 2 120024590 missense probably benign 0.00
R3976:Mapkbp1 UTSW 2 120021858 missense possibly damaging 0.94
R4009:Mapkbp1 UTSW 2 120023605 missense probably benign 0.00
R4183:Mapkbp1 UTSW 2 120017865 missense probably damaging 1.00
R4246:Mapkbp1 UTSW 2 120013027 missense probably damaging 1.00
R4503:Mapkbp1 UTSW 2 120015706 missense probably damaging 1.00
R4513:Mapkbp1 UTSW 2 120023693 missense possibly damaging 0.63
R4517:Mapkbp1 UTSW 2 120025064 intron probably benign
R4742:Mapkbp1 UTSW 2 120016818 missense probably damaging 1.00
R5049:Mapkbp1 UTSW 2 120015501 splice site probably benign
R5079:Mapkbp1 UTSW 2 120013733 missense probably damaging 0.99
R5137:Mapkbp1 UTSW 2 120022181 missense probably damaging 1.00
R5255:Mapkbp1 UTSW 2 120017254 missense probably damaging 1.00
R5530:Mapkbp1 UTSW 2 120015355 missense probably benign
R5546:Mapkbp1 UTSW 2 120019243 missense probably damaging 1.00
R5634:Mapkbp1 UTSW 2 119973095 missense probably damaging 1.00
R5696:Mapkbp1 UTSW 2 120021720 splice site probably null
R5891:Mapkbp1 UTSW 2 120023932 nonsense probably null
R6263:Mapkbp1 UTSW 2 120023291 missense probably damaging 1.00
R6807:Mapkbp1 UTSW 2 120021159 missense probably damaging 0.99
R6890:Mapkbp1 UTSW 2 120015802 missense probably damaging 1.00
R7159:Mapkbp1 UTSW 2 120025132 missense possibly damaging 0.72
R7467:Mapkbp1 UTSW 2 120022188 missense probably damaging 1.00
R7536:Mapkbp1 UTSW 2 120018585 missense probably damaging 1.00
R7564:Mapkbp1 UTSW 2 120013751 missense probably benign 0.09
R7801:Mapkbp1 UTSW 2 120012073 missense probably damaging 1.00
R7886:Mapkbp1 UTSW 2 120012647 missense possibly damaging 0.90
R8095:Mapkbp1 UTSW 2 120017650 missense probably benign 0.11
R8421:Mapkbp1 UTSW 2 120018950 missense probably damaging 0.99
R8548:Mapkbp1 UTSW 2 120024091 missense probably benign 0.33
R8856:Mapkbp1 UTSW 2 120014628 missense probably damaging 1.00
R8971:Mapkbp1 UTSW 2 120019569 missense probably benign
R9007:Mapkbp1 UTSW 2 120019662 missense probably damaging 0.99
R9251:Mapkbp1 UTSW 2 120023190 missense probably benign 0.00
R9255:Mapkbp1 UTSW 2 120013075 missense probably damaging 1.00
R9361:Mapkbp1 UTSW 2 120014771 missense probably benign 0.02
R9587:Mapkbp1 UTSW 2 120016796 missense possibly damaging 0.80
R9685:Mapkbp1 UTSW 2 120021183 missense probably benign 0.35
R9803:Mapkbp1 UTSW 2 120010775 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCGGAAGTCTAATTCTCTCCC -3'
(R):5'- AAAGCCTGAGTGTTCCCATC -3'

Sequencing Primer
(F):5'- GGAAGTCTAATTCTCTCCCTCTGTC -3'
(R):5'- GAGTGTTCCCATCCACATAGATG -3'
Posted On 2014-09-18