Incidental Mutation 'R2083:Cyp4a10'
ID 230136
Institutional Source Beutler Lab
Gene Symbol Cyp4a10
Ensembl Gene ENSMUSG00000066072
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 10
Synonyms Msp-3, Cyp4a, RP1, D4Rp1
MMRRC Submission 040088-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 115375484-115390846 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115382505 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 265 (V265A)
Ref Sequence ENSEMBL: ENSMUSP00000061126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058785] [ENSMUST00000094886]
AlphaFold O88833
Predicted Effect possibly damaging
Transcript: ENSMUST00000058785
AA Change: V265A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061126
Gene: ENSMUSG00000066072
AA Change: V265A

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 504 2.3e-133 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094886
AA Change: V255A

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092486
Gene: ENSMUSG00000066072
AA Change: V255A

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:p450 51 494 4.5e-129 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display salt-sensitive hypertension, decrease sodium excretion, and decreased urine output. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,121,681 (GRCm39) M73L possibly damaging Het
AA986860 A T 1: 130,668,806 (GRCm39) I58F probably damaging Het
Acsl3 A T 1: 78,677,528 (GRCm39) K507N probably damaging Het
Adcy3 T C 12: 4,223,512 (GRCm39) Y245H probably damaging Het
Adgra1 T C 7: 139,455,547 (GRCm39) S392P probably damaging Het
Ahnak C T 19: 8,988,921 (GRCm39) P3402S probably damaging Het
Ambra1 T A 2: 91,596,945 (GRCm39) I12N possibly damaging Het
Atp10b A G 11: 43,103,250 (GRCm39) T545A probably benign Het
Atxn2 G T 5: 121,922,069 (GRCm39) A638S probably benign Het
Cd109 T C 9: 78,574,575 (GRCm39) S520P probably damaging Het
Col6a3 T C 1: 90,709,733 (GRCm39) D1821G unknown Het
Dmrtb1 C T 4: 107,540,809 (GRCm39) R184Q possibly damaging Het
Dnah7b A T 1: 46,280,227 (GRCm39) I2719F possibly damaging Het
En2 T C 5: 28,372,071 (GRCm39) S183P probably damaging Het
Etfb A G 7: 43,105,924 (GRCm39) T101A probably benign Het
Etl4 T A 2: 20,748,360 (GRCm39) S364T probably damaging Het
Gm17728 C A 17: 9,641,121 (GRCm39) S77Y possibly damaging Het
Golga4 A G 9: 118,361,658 (GRCm39) E221G probably damaging Het
Gpr37 T C 6: 25,688,416 (GRCm39) N227S possibly damaging Het
Insyn2b A G 11: 34,352,141 (GRCm39) D61G probably benign Het
Kctd1 A T 18: 15,107,112 (GRCm39) N784K possibly damaging Het
Klhl22 A G 16: 17,594,389 (GRCm39) T173A probably benign Het
Ly6e T A 15: 74,830,168 (GRCm39) C41S probably damaging Het
Mapkbp1 T C 2: 119,845,963 (GRCm39) L444P possibly damaging Het
Mkx A T 18: 6,992,855 (GRCm39) I143K probably damaging Het
Mlh3 A G 12: 85,315,815 (GRCm39) F124L probably benign Het
Nlrp1a A T 11: 71,015,046 (GRCm39) L68H possibly damaging Het
Obscn A C 11: 58,964,457 (GRCm39) Y726* probably null Het
Or4f59 C T 2: 111,872,898 (GRCm39) V160I probably benign Het
Or8d1 T G 9: 38,766,637 (GRCm39) V93G probably benign Het
Peak1 G A 9: 56,166,233 (GRCm39) S565L probably damaging Het
Pter T A 2: 12,983,247 (GRCm39) L84Q probably damaging Het
Ptpn4 A G 1: 119,615,489 (GRCm39) L555P possibly damaging Het
Rpp40 A T 13: 36,082,975 (GRCm39) M171K probably benign Het
Sacs A G 14: 61,443,955 (GRCm39) I2000M possibly damaging Het
Scn5a T C 9: 119,321,189 (GRCm39) I1458V probably benign Het
Slc38a4 T C 15: 96,906,874 (GRCm39) D288G probably benign Het
Slc8a2 T G 7: 15,868,440 (GRCm39) V224G probably damaging Het
Sptbn4 T C 7: 27,127,681 (GRCm39) E173G probably benign Het
Tas1r1 T A 4: 152,112,848 (GRCm39) H735L probably benign Het
Trps1 G T 15: 50,685,701 (GRCm39) Q155K probably damaging Het
Tspyl5 T C 15: 33,686,892 (GRCm39) H351R probably damaging Het
Ttf2 A T 3: 100,876,817 (GRCm39) D21E probably benign Het
Ttll7 A G 3: 146,635,859 (GRCm39) R398G possibly damaging Het
Tubgcp6 A T 15: 89,006,579 (GRCm39) Y148N probably damaging Het
Vmn1r8 T A 6: 57,013,325 (GRCm39) H125Q probably benign Het
Zfhx4 A G 3: 5,468,223 (GRCm39) T2794A possibly damaging Het
Zfp27 T C 7: 29,594,208 (GRCm39) I586V probably benign Het
Zfyve16 T C 13: 92,660,770 (GRCm39) D13G probably damaging Het
Other mutations in Cyp4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00774:Cyp4a10 APN 4 115,389,735 (GRCm39) missense probably damaging 1.00
IGL01301:Cyp4a10 APN 4 115,375,652 (GRCm39) missense probably damaging 1.00
IGL02081:Cyp4a10 APN 4 115,378,369 (GRCm39) missense possibly damaging 0.87
IGL02373:Cyp4a10 APN 4 115,378,274 (GRCm39) nonsense probably null
IGL03411:Cyp4a10 APN 4 115,382,890 (GRCm39) splice site probably null
ANU18:Cyp4a10 UTSW 4 115,375,652 (GRCm39) missense probably damaging 1.00
PIT4142001:Cyp4a10 UTSW 4 115,382,072 (GRCm39) missense probably damaging 0.99
PIT4151001:Cyp4a10 UTSW 4 115,382,072 (GRCm39) missense probably damaging 0.99
R0016:Cyp4a10 UTSW 4 115,378,304 (GRCm39) missense probably damaging 1.00
R0368:Cyp4a10 UTSW 4 115,382,574 (GRCm39) nonsense probably null
R1319:Cyp4a10 UTSW 4 115,378,342 (GRCm39) missense probably damaging 0.98
R1440:Cyp4a10 UTSW 4 115,386,646 (GRCm39) missense probably damaging 1.00
R1531:Cyp4a10 UTSW 4 115,375,632 (GRCm39) nonsense probably null
R2008:Cyp4a10 UTSW 4 115,382,589 (GRCm39) missense probably damaging 0.98
R2064:Cyp4a10 UTSW 4 115,381,917 (GRCm39) splice site probably benign
R2961:Cyp4a10 UTSW 4 115,377,467 (GRCm39) missense probably benign 0.02
R3028:Cyp4a10 UTSW 4 115,375,628 (GRCm39) missense possibly damaging 0.64
R3839:Cyp4a10 UTSW 4 115,382,544 (GRCm39) missense possibly damaging 0.85
R3930:Cyp4a10 UTSW 4 115,381,980 (GRCm39) missense probably benign 0.00
R4062:Cyp4a10 UTSW 4 115,376,898 (GRCm39) missense probably benign 0.06
R4097:Cyp4a10 UTSW 4 115,386,480 (GRCm39) missense probably damaging 0.99
R4298:Cyp4a10 UTSW 4 115,389,889 (GRCm39) missense probably damaging 1.00
R4482:Cyp4a10 UTSW 4 115,389,795 (GRCm39) missense probably damaging 1.00
R4592:Cyp4a10 UTSW 4 115,386,690 (GRCm39) missense probably damaging 0.99
R4715:Cyp4a10 UTSW 4 115,382,535 (GRCm39) missense probably benign 0.44
R4826:Cyp4a10 UTSW 4 115,375,541 (GRCm39) missense probably benign 0.00
R4834:Cyp4a10 UTSW 4 115,383,005 (GRCm39) missense probably damaging 1.00
R4922:Cyp4a10 UTSW 4 115,378,291 (GRCm39) missense probably benign 0.01
R5202:Cyp4a10 UTSW 4 115,389,812 (GRCm39) missense probably damaging 1.00
R5502:Cyp4a10 UTSW 4 115,382,702 (GRCm39) missense probably benign 0.21
R6269:Cyp4a10 UTSW 4 115,381,509 (GRCm39) missense probably damaging 1.00
R6349:Cyp4a10 UTSW 4 115,382,555 (GRCm39) missense probably benign 0.00
R7684:Cyp4a10 UTSW 4 115,375,549 (GRCm39) missense probably benign 0.18
R7863:Cyp4a10 UTSW 4 115,375,622 (GRCm39) missense probably benign 0.00
R8392:Cyp4a10 UTSW 4 115,386,675 (GRCm39) nonsense probably null
R8445:Cyp4a10 UTSW 4 115,382,791 (GRCm39) missense probably damaging 1.00
R8744:Cyp4a10 UTSW 4 115,386,667 (GRCm39) missense probably benign 0.00
R9264:Cyp4a10 UTSW 4 115,381,475 (GRCm39) missense probably benign 0.03
R9297:Cyp4a10 UTSW 4 115,378,375 (GRCm39) missense probably damaging 1.00
R9299:Cyp4a10 UTSW 4 115,376,947 (GRCm39) missense probably benign 0.00
R9393:Cyp4a10 UTSW 4 115,382,566 (GRCm39) missense probably damaging 1.00
Z1176:Cyp4a10 UTSW 4 115,375,523 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTAGTGAGACTTGACCGAGC -3'
(R):5'- AGGCATTGTCAGAGCTATGC -3'

Sequencing Primer
(F):5'- GTCAAGCAGAGCTTCCATTG -3'
(R):5'- GCATTGTCAGAGCTATGCTTGTTCC -3'
Posted On 2014-09-18