Incidental Mutation 'R2083:Etfb'
ID 230148
Institutional Source Beutler Lab
Gene Symbol Etfb
Ensembl Gene ENSMUSG00000004610
Gene Name electron transferring flavoprotein, beta polypeptide
Synonyms 2810441H06Rik, 0610009I16Rik
MMRRC Submission 040088-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.565) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 43093507-43107224 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43105924 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 101 (T101A)
Ref Sequence ENSEMBL: ENSMUSP00000145608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004729] [ENSMUST00000203633] [ENSMUST00000204680] [ENSMUST00000206196] [ENSMUST00000206286]
AlphaFold Q9DCW4
Predicted Effect probably benign
Transcript: ENSMUST00000004729
AA Change: T154A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004729
Gene: ENSMUSG00000004610
AA Change: T154A

DomainStartEndE-ValueType
ETF 26 218 4.15e-67 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184167
Predicted Effect probably benign
Transcript: ENSMUST00000203633
AA Change: T154A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145061
Gene: ENSMUSG00000107482
AA Change: T154A

DomainStartEndE-ValueType
ETF 26 216 2.7e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204680
SMART Domains Protein: ENSMUSP00000145493
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 168 2.4e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205363
Predicted Effect probably benign
Transcript: ENSMUST00000206196
AA Change: T154A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206286
AA Change: T101A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect unknown
Transcript: ENSMUST00000206411
AA Change: T153A
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes electron-transfer-flavoprotein, beta polypeptide, which shuttles electrons between primary flavoprotein dehydrogenases involved in mitochondrial fatty acid and amino acid catabolism and the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase. The gene deficiencies have been implicated in type II glutaricaciduria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,121,681 (GRCm39) M73L possibly damaging Het
AA986860 A T 1: 130,668,806 (GRCm39) I58F probably damaging Het
Acsl3 A T 1: 78,677,528 (GRCm39) K507N probably damaging Het
Adcy3 T C 12: 4,223,512 (GRCm39) Y245H probably damaging Het
Adgra1 T C 7: 139,455,547 (GRCm39) S392P probably damaging Het
Ahnak C T 19: 8,988,921 (GRCm39) P3402S probably damaging Het
Ambra1 T A 2: 91,596,945 (GRCm39) I12N possibly damaging Het
Atp10b A G 11: 43,103,250 (GRCm39) T545A probably benign Het
Atxn2 G T 5: 121,922,069 (GRCm39) A638S probably benign Het
Cd109 T C 9: 78,574,575 (GRCm39) S520P probably damaging Het
Col6a3 T C 1: 90,709,733 (GRCm39) D1821G unknown Het
Cyp4a10 T C 4: 115,382,505 (GRCm39) V265A possibly damaging Het
Dmrtb1 C T 4: 107,540,809 (GRCm39) R184Q possibly damaging Het
Dnah7b A T 1: 46,280,227 (GRCm39) I2719F possibly damaging Het
En2 T C 5: 28,372,071 (GRCm39) S183P probably damaging Het
Etl4 T A 2: 20,748,360 (GRCm39) S364T probably damaging Het
Gm17728 C A 17: 9,641,121 (GRCm39) S77Y possibly damaging Het
Golga4 A G 9: 118,361,658 (GRCm39) E221G probably damaging Het
Gpr37 T C 6: 25,688,416 (GRCm39) N227S possibly damaging Het
Insyn2b A G 11: 34,352,141 (GRCm39) D61G probably benign Het
Kctd1 A T 18: 15,107,112 (GRCm39) N784K possibly damaging Het
Klhl22 A G 16: 17,594,389 (GRCm39) T173A probably benign Het
Ly6e T A 15: 74,830,168 (GRCm39) C41S probably damaging Het
Mapkbp1 T C 2: 119,845,963 (GRCm39) L444P possibly damaging Het
Mkx A T 18: 6,992,855 (GRCm39) I143K probably damaging Het
Mlh3 A G 12: 85,315,815 (GRCm39) F124L probably benign Het
Nlrp1a A T 11: 71,015,046 (GRCm39) L68H possibly damaging Het
Obscn A C 11: 58,964,457 (GRCm39) Y726* probably null Het
Or4f59 C T 2: 111,872,898 (GRCm39) V160I probably benign Het
Or8d1 T G 9: 38,766,637 (GRCm39) V93G probably benign Het
Peak1 G A 9: 56,166,233 (GRCm39) S565L probably damaging Het
Pter T A 2: 12,983,247 (GRCm39) L84Q probably damaging Het
Ptpn4 A G 1: 119,615,489 (GRCm39) L555P possibly damaging Het
Rpp40 A T 13: 36,082,975 (GRCm39) M171K probably benign Het
Sacs A G 14: 61,443,955 (GRCm39) I2000M possibly damaging Het
Scn5a T C 9: 119,321,189 (GRCm39) I1458V probably benign Het
Slc38a4 T C 15: 96,906,874 (GRCm39) D288G probably benign Het
Slc8a2 T G 7: 15,868,440 (GRCm39) V224G probably damaging Het
Sptbn4 T C 7: 27,127,681 (GRCm39) E173G probably benign Het
Tas1r1 T A 4: 152,112,848 (GRCm39) H735L probably benign Het
Trps1 G T 15: 50,685,701 (GRCm39) Q155K probably damaging Het
Tspyl5 T C 15: 33,686,892 (GRCm39) H351R probably damaging Het
Ttf2 A T 3: 100,876,817 (GRCm39) D21E probably benign Het
Ttll7 A G 3: 146,635,859 (GRCm39) R398G possibly damaging Het
Tubgcp6 A T 15: 89,006,579 (GRCm39) Y148N probably damaging Het
Vmn1r8 T A 6: 57,013,325 (GRCm39) H125Q probably benign Het
Zfhx4 A G 3: 5,468,223 (GRCm39) T2794A possibly damaging Het
Zfp27 T C 7: 29,594,208 (GRCm39) I586V probably benign Het
Zfyve16 T C 13: 92,660,770 (GRCm39) D13G probably damaging Het
Other mutations in Etfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Etfb APN 7 43,102,383 (GRCm39) critical splice donor site probably null
IGL01782:Etfb APN 7 43,103,966 (GRCm39) missense probably damaging 0.97
IGL03264:Etfb APN 7 43,101,897 (GRCm39) missense probably damaging 1.00
R0547:Etfb UTSW 7 43,104,002 (GRCm39) nonsense probably null
R1999:Etfb UTSW 7 43,103,987 (GRCm39) missense probably benign 0.01
R4229:Etfb UTSW 7 43,105,984 (GRCm39) missense probably damaging 1.00
R4731:Etfb UTSW 7 43,093,624 (GRCm39) missense probably damaging 1.00
R4732:Etfb UTSW 7 43,093,624 (GRCm39) missense probably damaging 1.00
R4733:Etfb UTSW 7 43,093,624 (GRCm39) missense probably damaging 1.00
R6366:Etfb UTSW 7 43,102,365 (GRCm39) missense probably damaging 1.00
R6993:Etfb UTSW 7 43,105,978 (GRCm39) missense possibly damaging 0.88
R7493:Etfb UTSW 7 43,104,000 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCAGAGTTTGCAGTG -3'
(R):5'- CATCCAATCACTGAGGAGGCAC -3'

Sequencing Primer
(F):5'- CACCAGAGTTTGCAGTGCTGTG -3'
(R):5'- TCACTGAGGAGGCACCAAGTC -3'
Posted On 2014-09-18