Mutagenetix > Incidental Mutation

Incidental Mutation 'R2083:Adgra1'

230149

Institutional Source

Beutler Lab

Gene Symbol

Adgra1

Ensembl Gene

ENSMUSG00000025475

Gene Name

adhesion G protein-coupled receptor A1

Synonyms

Gpr123, D7Ertd680e, 2900059M17Rik

MMRRC Submission

040088-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R2083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139834174-139878088 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139875631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 392 (S392P)

Ref Sequence

ENSEMBL: ENSMUSP00000026548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026548]

AlphaFold

Q8C4G9

Predicted Effect

probably damaging
Transcript: ENSMUST00000026548
AA Change: S392P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000026548
Gene: ENSMUSG00000025475
AA Change: S392P

Domain	Start	End	E-Value	Type
Pfam:7tm_2	19	307	1.4e-16	PFAM
low complexity region	407	419	N/A	INTRINSIC
low complexity region	423	434	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the adhesion family of G-protein-coupled receptors. Members of this family function in several sensory systems and regulate blood pressure, immune responses, food intake and development. A similar protein in rodents is thought to play a role in in the regulation of neuronal signaling pathways. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	T	A	5: 146,184,871	M73L	possibly damaging	Het
AA986860	A	T	1: 130,741,069	I58F	probably damaging	Het
Acsl3	A	T	1: 78,699,811	K507N	probably damaging	Het
Adcy3	T	C	12: 4,173,512	Y245H	probably damaging	Het
Ahnak	C	T	19: 9,011,557	P3402S	probably damaging	Het
Ambra1	T	A	2: 91,766,600	I12N	possibly damaging	Het
Atp10b	A	G	11: 43,212,423	T545A	probably benign	Het
Atxn2	G	T	5: 121,784,006	A638S	probably benign	Het
Cd109	T	C	9: 78,667,293	S520P	probably damaging	Het
Col6a3	T	C	1: 90,782,011	D1821G	unknown	Het
Cyp4a10	T	C	4: 115,525,308	V265A	possibly damaging	Het
Dmrtb1	C	T	4: 107,683,612	R184Q	possibly damaging	Het
Dnah7b	A	T	1: 46,241,067	I2719F	possibly damaging	Het
En2	T	C	5: 28,167,073	S183P	probably damaging	Het
Etfb	A	G	7: 43,456,500	T101A	probably benign	Het
Etl4	T	A	2: 20,743,549	S364T	probably damaging	Het
Fam196b	A	G	11: 34,402,141	D61G	probably benign	Het
Gm17728	C	A	17: 9,422,289	S77Y	possibly damaging	Het
Golga4	A	G	9: 118,532,590	E221G	probably damaging	Het
Gpr37	T	C	6: 25,688,417	N227S	possibly damaging	Het
Kctd1	A	T	18: 14,974,055	N784K	possibly damaging	Het
Klhl22	A	G	16: 17,776,525	T173A	probably benign	Het
Ly6e	T	A	15: 74,958,319	C41S	probably damaging	Het
Mapkbp1	T	C	2: 120,015,482	L444P	possibly damaging	Het
Mkx	A	T	18: 6,992,855	I143K	probably damaging	Het
Mlh3	A	G	12: 85,269,041	F124L	probably benign	Het
Nlrp1a	A	T	11: 71,124,220	L68H	possibly damaging	Het
Obscn	A	C	11: 59,073,631	Y726*	probably null	Het
Olfr1312	C	T	2: 112,042,553	V160I	probably benign	Het
Olfr26	T	G	9: 38,855,341	V93G	probably benign	Het
Peak1	G	A	9: 56,258,949	S565L	probably damaging	Het
Pter	T	A	2: 12,978,436	L84Q	probably damaging	Het
Ptpn4	A	G	1: 119,687,759	L555P	possibly damaging	Het
Rpp40	A	T	13: 35,898,992	M171K	probably benign	Het
Sacs	A	G	14: 61,206,506	I2000M	possibly damaging	Het
Scn5a	T	C	9: 119,492,123	I1458V	probably benign	Het
Slc38a4	T	C	15: 97,008,993	D288G	probably benign	Het
Slc8a2	T	G	7: 16,134,515	V224G	probably damaging	Het
Sptbn4	T	C	7: 27,428,256	E173G	probably benign	Het
Tas1r1	T	A	4: 152,028,391	H735L	probably benign	Het
Trps1	G	T	15: 50,822,305	Q155K	probably damaging	Het
Tspyl5	T	C	15: 33,686,746	H351R	probably damaging	Het
Ttf2	A	T	3: 100,969,501	D21E	probably benign	Het
Ttll7	A	G	3: 146,930,104	R398G	possibly damaging	Het
Tubgcp6	A	T	15: 89,122,376	Y148N	probably damaging	Het
Vmn1r8	T	A	6: 57,036,340	H125Q	probably benign	Het
Zfhx4	A	G	3: 5,403,163	T2794A	possibly damaging	Het
Zfp27	T	C	7: 29,894,783	I586V	probably benign	Het
Zfyve16	T	C	13: 92,524,262	D13G	probably damaging	Het

Other mutations in Adgra1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Adgra1	APN	7	139875944	missense	probably benign	0.01
IGL01014:Adgra1	APN	7	139875660	missense	probably benign	0.05
IGL01014:Adgra1	APN	7	139875661	missense	probably damaging	1.00
IGL01068:Adgra1	APN	7	139845625	missense	probably damaging	0.96
IGL01095:Adgra1	APN	7	139845654	missense	possibly damaging	0.79
IGL02717:Adgra1	APN	7	139876178	missense	probably damaging	0.98
adaga	UTSW	7	139875280	missense	probably damaging	1.00
I2288:Adgra1	UTSW	7	139852579	missense	probably damaging	0.98
R0630:Adgra1	UTSW	7	139852584	nonsense	probably null
R0653:Adgra1	UTSW	7	139876147	missense	probably damaging	0.98
R1388:Adgra1	UTSW	7	139874003	missense	probably damaging	0.97
R1462:Adgra1	UTSW	7	139875829	missense	probably damaging	1.00
R1462:Adgra1	UTSW	7	139875829	missense	probably damaging	1.00
R1667:Adgra1	UTSW	7	139845648	missense	possibly damaging	0.95
R1770:Adgra1	UTSW	7	139874031	nonsense	probably null
R2967:Adgra1	UTSW	7	139875685	missense	possibly damaging	0.68
R3410:Adgra1	UTSW	7	139847703	missense	possibly damaging	0.94
R3411:Adgra1	UTSW	7	139847703	missense	possibly damaging	0.94
R3687:Adgra1	UTSW	7	139852590	missense	probably damaging	1.00
R3804:Adgra1	UTSW	7	139845594	missense	probably benign	0.01
R3912:Adgra1	UTSW	7	139845714	critical splice donor site	probably null
R4452:Adgra1	UTSW	7	139852521	missense	probably benign	0.02
R4466:Adgra1	UTSW	7	139840836	intron	probably benign
R4469:Adgra1	UTSW	7	139876061	missense	probably damaging	0.96
R4675:Adgra1	UTSW	7	139876186	missense	probably damaging	1.00
R4724:Adgra1	UTSW	7	139875589	missense	probably benign
R5220:Adgra1	UTSW	7	139875596	missense	probably benign	0.06
R5846:Adgra1	UTSW	7	139875280	missense	probably damaging	1.00
R5972:Adgra1	UTSW	7	139845667	missense	probably damaging	1.00
R6453:Adgra1	UTSW	7	139875427	missense	probably benign	0.09
R7242:Adgra1	UTSW	7	139847657	critical splice acceptor site	probably null
R7343:Adgra1	UTSW	7	139876142	missense	probably damaging	1.00
R7774:Adgra1	UTSW	7	139847712	missense	possibly damaging	0.79
R8190:Adgra1	UTSW	7	139876118	missense	probably benign
R8355:Adgra1	UTSW	7	139875651	nonsense	probably null
R8455:Adgra1	UTSW	7	139875651	nonsense	probably null
R8905:Adgra1	UTSW	7	139875847	missense	probably damaging	1.00
R9045:Adgra1	UTSW	7	139852650	missense	possibly damaging	0.64
R9056:Adgra1	UTSW	7	139852576	missense	probably damaging	1.00
R9183:Adgra1	UTSW	7	139875800	missense	probably benign	0.24
R9438:Adgra1	UTSW	7	139852609	missense	probably benign	0.00
V1662:Adgra1	UTSW	7	139852579	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTATCCATCACTGCGCCAAG -3'
(R):5'- GTAAGCATACTCCCTCTCAGCC -3'

Sequencing Primer
(F):5'- AGGACGTGTGGCAGTGC -3'
(R):5'- TCCCTCTCAGCCGCAGC -3'

Posted On

2014-09-18