Incidental Mutation 'R2083:Adgra1'
ID230149
Institutional Source Beutler Lab
Gene Symbol Adgra1
Ensembl Gene ENSMUSG00000025475
Gene Nameadhesion G protein-coupled receptor A1
SynonymsGpr123, D7Ertd680e, 2900059M17Rik
MMRRC Submission 040088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R2083 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location139834174-139878088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139875631 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 392 (S392P)
Ref Sequence ENSEMBL: ENSMUSP00000026548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026548]
Predicted Effect probably damaging
Transcript: ENSMUST00000026548
AA Change: S392P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026548
Gene: ENSMUSG00000025475
AA Change: S392P

DomainStartEndE-ValueType
Pfam:7tm_2 19 307 1.4e-16 PFAM
low complexity region 407 419 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the adhesion family of G-protein-coupled receptors. Members of this family function in several sensory systems and regulate blood pressure, immune responses, food intake and development. A similar protein in rodents is thought to play a role in in the regulation of neuronal signaling pathways. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,184,871 M73L possibly damaging Het
AA986860 A T 1: 130,741,069 I58F probably damaging Het
Acsl3 A T 1: 78,699,811 K507N probably damaging Het
Adcy3 T C 12: 4,173,512 Y245H probably damaging Het
Ahnak C T 19: 9,011,557 P3402S probably damaging Het
Ambra1 T A 2: 91,766,600 I12N possibly damaging Het
Atp10b A G 11: 43,212,423 T545A probably benign Het
Atxn2 G T 5: 121,784,006 A638S probably benign Het
Cd109 T C 9: 78,667,293 S520P probably damaging Het
Col6a3 T C 1: 90,782,011 D1821G unknown Het
Cyp4a10 T C 4: 115,525,308 V265A possibly damaging Het
Dmrtb1 C T 4: 107,683,612 R184Q possibly damaging Het
Dnah7b A T 1: 46,241,067 I2719F possibly damaging Het
En2 T C 5: 28,167,073 S183P probably damaging Het
Etfb A G 7: 43,456,500 T101A probably benign Het
Etl4 T A 2: 20,743,549 S364T probably damaging Het
Fam196b A G 11: 34,402,141 D61G probably benign Het
Gm17728 C A 17: 9,422,289 S77Y possibly damaging Het
Golga4 A G 9: 118,532,590 E221G probably damaging Het
Gpr37 T C 6: 25,688,417 N227S possibly damaging Het
Kctd1 A T 18: 14,974,055 N784K possibly damaging Het
Klhl22 A G 16: 17,776,525 T173A probably benign Het
Ly6e T A 15: 74,958,319 C41S probably damaging Het
Mapkbp1 T C 2: 120,015,482 L444P possibly damaging Het
Mkx A T 18: 6,992,855 I143K probably damaging Het
Mlh3 A G 12: 85,269,041 F124L probably benign Het
Nlrp1a A T 11: 71,124,220 L68H possibly damaging Het
Obscn A C 11: 59,073,631 Y726* probably null Het
Olfr1312 C T 2: 112,042,553 V160I probably benign Het
Olfr26 T G 9: 38,855,341 V93G probably benign Het
Peak1 G A 9: 56,258,949 S565L probably damaging Het
Pter T A 2: 12,978,436 L84Q probably damaging Het
Ptpn4 A G 1: 119,687,759 L555P possibly damaging Het
Rpp40 A T 13: 35,898,992 M171K probably benign Het
Sacs A G 14: 61,206,506 I2000M possibly damaging Het
Scn5a T C 9: 119,492,123 I1458V probably benign Het
Slc38a4 T C 15: 97,008,993 D288G probably benign Het
Slc8a2 T G 7: 16,134,515 V224G probably damaging Het
Sptbn4 T C 7: 27,428,256 E173G probably benign Het
Tas1r1 T A 4: 152,028,391 H735L probably benign Het
Trps1 G T 15: 50,822,305 Q155K probably damaging Het
Tspyl5 T C 15: 33,686,746 H351R probably damaging Het
Ttf2 A T 3: 100,969,501 D21E probably benign Het
Ttll7 A G 3: 146,930,104 R398G possibly damaging Het
Tubgcp6 A T 15: 89,122,376 Y148N probably damaging Het
Vmn1r8 T A 6: 57,036,340 H125Q probably benign Het
Zfhx4 A G 3: 5,403,163 T2794A possibly damaging Het
Zfp27 T C 7: 29,894,783 I586V probably benign Het
Zfyve16 T C 13: 92,524,262 D13G probably damaging Het
Other mutations in Adgra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Adgra1 APN 7 139875944 missense probably benign 0.01
IGL01014:Adgra1 APN 7 139875660 missense probably benign 0.05
IGL01014:Adgra1 APN 7 139875661 missense probably damaging 1.00
IGL01068:Adgra1 APN 7 139845625 missense probably damaging 0.96
IGL01095:Adgra1 APN 7 139845654 missense possibly damaging 0.79
IGL02717:Adgra1 APN 7 139876178 missense probably damaging 0.98
adaga UTSW 7 139875280 missense probably damaging 1.00
I2288:Adgra1 UTSW 7 139852579 missense probably damaging 0.98
R0630:Adgra1 UTSW 7 139852584 nonsense probably null
R0653:Adgra1 UTSW 7 139876147 missense probably damaging 0.98
R1388:Adgra1 UTSW 7 139874003 missense probably damaging 0.97
R1462:Adgra1 UTSW 7 139875829 missense probably damaging 1.00
R1462:Adgra1 UTSW 7 139875829 missense probably damaging 1.00
R1667:Adgra1 UTSW 7 139845648 missense possibly damaging 0.95
R1770:Adgra1 UTSW 7 139874031 nonsense probably null
R2967:Adgra1 UTSW 7 139875685 missense possibly damaging 0.68
R3410:Adgra1 UTSW 7 139847703 missense possibly damaging 0.94
R3411:Adgra1 UTSW 7 139847703 missense possibly damaging 0.94
R3687:Adgra1 UTSW 7 139852590 missense probably damaging 1.00
R3804:Adgra1 UTSW 7 139845594 missense probably benign 0.01
R3912:Adgra1 UTSW 7 139845714 critical splice donor site probably null
R4452:Adgra1 UTSW 7 139852521 missense probably benign 0.02
R4466:Adgra1 UTSW 7 139840836 intron probably benign
R4469:Adgra1 UTSW 7 139876061 missense probably damaging 0.96
R4675:Adgra1 UTSW 7 139876186 missense probably damaging 1.00
R4724:Adgra1 UTSW 7 139875589 missense probably benign
R5220:Adgra1 UTSW 7 139875596 missense probably benign 0.06
R5846:Adgra1 UTSW 7 139875280 missense probably damaging 1.00
R5972:Adgra1 UTSW 7 139845667 missense probably damaging 1.00
R6453:Adgra1 UTSW 7 139875427 missense probably benign 0.09
R7242:Adgra1 UTSW 7 139847657 critical splice acceptor site probably null
R7343:Adgra1 UTSW 7 139876142 missense probably damaging 1.00
R7774:Adgra1 UTSW 7 139847712 missense possibly damaging 0.79
R8190:Adgra1 UTSW 7 139876118 missense probably benign
R8355:Adgra1 UTSW 7 139875651 nonsense probably null
R8455:Adgra1 UTSW 7 139875651 nonsense probably null
R8905:Adgra1 UTSW 7 139875847 missense probably damaging 1.00
V1662:Adgra1 UTSW 7 139852579 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTATCCATCACTGCGCCAAG -3'
(R):5'- GTAAGCATACTCCCTCTCAGCC -3'

Sequencing Primer
(F):5'- AGGACGTGTGGCAGTGC -3'
(R):5'- TCCCTCTCAGCCGCAGC -3'
Posted On2014-09-18