Mutagenetix > Incidental Mutations

Incidental Mutation 'R0179:Eprs'

23015

Institutional Source

Beutler Lab

Gene Symbol

Eprs

Ensembl Gene

ENSMUSG00000026615

Gene Name

glutamyl-prolyl-tRNA synthetase

Synonyms

2410081F06Rik, 3010002K18Rik, Qprs

MMRRC Submission

038447-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0179 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

185363044-185428360 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 185413547 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1184 (D1184E)

Ref Sequence

ENSEMBL: ENSMUSP00000045841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046514]

Predicted Effect

probably benign
Transcript: ENSMUST00000046514
AA Change: D1184E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615
AA Change: D1184E

Domain	Start	End	E-Value	Type
Pfam:GST_C_3	71	156	2.1e-15	PFAM
Pfam:GST_C	72	157	2.9e-7	PFAM
Pfam:tRNA-synt_1c	197	502	8.8e-127	PFAM
Pfam:tRNA-synt_1c_C	504	681	4.4e-42	PFAM
WHEP-TRS	753	815	1.26e-25	SMART
WHEP-TRS	826	888	1.47e-26	SMART
WHEP-TRS	904	966	3.76e-24	SMART
low complexity region	984	1011	N/A	INTRINSIC
Pfam:tRNA-synt_2b	1107	1287	3.1e-17	PFAM
Pfam:HGTP_anticodon	1303	1404	1.7e-19	PFAM
ProRS-C_1	1430	1512	5.27e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192284

Meta Mutation Damage Score

0.1504

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,972,214	S516P	probably benign	Het
4932431P20Rik	A	G	7: 29,535,940		noncoding transcript	Het
Adamts1	C	T	16: 85,795,465	S948N	probably benign	Het
Adck1	A	T	12: 88,459,172	M457L	possibly damaging	Het
Adprm	A	T	11: 67,038,225	H313Q	possibly damaging	Het
Adssl1	T	C	12: 112,632,269	I104T	probably benign	Het
Agxt2	A	C	15: 10,399,048	Q435P	possibly damaging	Het
Amotl1	G	A	9: 14,548,773	A890V	probably benign	Het
Ankrd50	A	G	3: 38,455,314	V968A	possibly damaging	Het
Brf2	T	C	8: 27,125,868	D163G	possibly damaging	Het
Cd226	C	A	18: 89,207,139	N53K	probably benign	Het
Cdc42ep2	T	C	19: 5,918,608	D23G	probably benign	Het
Cdc7	T	C	5: 106,965,039	S8P	probably benign	Het
Cdh8	C	T	8: 99,111,712	E499K	possibly damaging	Het
Chd7	T	A	4: 8,862,516	F2534L	probably benign	Het
Ckb	T	C	12: 111,670,176	T255A	probably benign	Het
Cntnap5c	G	T	17: 57,769,625	W19L	probably benign	Het
Cntrl	A	G	2: 35,167,859	E1854G	probably benign	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cop1	A	G	1: 159,250,066	D157G	probably benign	Het
Csf2rb	A	C	15: 78,336,372	Q38P	possibly damaging	Het
Ctla2b	T	C	13: 60,896,293	D52G	possibly damaging	Het
Dcaf7	A	T	11: 106,051,797	D190V	probably damaging	Het
Depdc5	T	A	5: 32,901,574		probably benign	Het
Dgkq	A	G	5: 108,658,200		probably benign	Het
Dhrs2	A	G	14: 55,240,476	T222A	probably damaging	Het
Dock1	G	A	7: 135,098,837	D1109N	probably damaging	Het
E4f1	G	C	17: 24,451,437	T92S	possibly damaging	Het
Ep400	A	T	5: 110,668,649	S2669T	probably damaging	Het
Fpr-rs4	A	T	17: 18,022,027	K99*	probably null	Het
Fzr1	A	T	10: 81,369,070		probably benign	Het
Gcc2	C	T	10: 58,276,650	R1001C	probably benign	Het
Gm4884	A	G	7: 41,043,828	D407G	probably benign	Het
Golga4	A	T	9: 118,560,740		probably null	Het
Gp2	T	G	7: 119,452,317	D225A	possibly damaging	Het
Gramd1a	T	A	7: 31,142,418	T120S	probably damaging	Het
Hbb-bh2	T	A	7: 103,839,227	N121I	probably benign	Het
Htr6	A	T	4: 139,062,126	L276Q	probably damaging	Het
Itga9	A	T	9: 118,661,386	I262F	probably benign	Het
Lamc3	A	G	2: 31,915,084		probably benign	Het
Large1	T	C	8: 73,098,846	N200S	probably benign	Het
Lct	C	T	1: 128,327,685	V207I	probably benign	Het
Marf1	C	A	16: 14,151,176	L144F	probably damaging	Het
Morc2b	A	T	17: 33,136,982	Y605*	probably null	Het
Mtus1	G	T	8: 41,002,361	L87I	possibly damaging	Het
Muc2	A	G	7: 141,748,971	Y17C	probably damaging	Het
Myf5	T	C	10: 107,485,918	D5G	possibly damaging	Het
Nasp	C	T	4: 116,602,157	V375M	probably damaging	Het
Nr1h2	A	T	7: 44,552,265		probably null	Het
Nrg2	T	C	18: 36,022,415	Q447R	probably benign	Het
Ntn5	G	A	7: 45,686,313	G56D	probably damaging	Het
Oasl2	A	G	5: 114,910,912	R138G	probably benign	Het
Olfr1209	A	T	2: 88,909,893	C167S	possibly damaging	Het
Olfr1489	T	A	19: 13,633,140	F10I	probably damaging	Het
Olfr827	T	C	10: 130,210,338	Y264C	probably damaging	Het
Pcdhb5	G	A	18: 37,322,559	G664D	probably damaging	Het
Ppp1r15a	T	C	7: 45,525,000	E128G	probably damaging	Het
Prpf19	T	C	19: 10,897,808		probably benign	Het
Ptpn3	T	A	4: 57,270,118	T15S	probably benign	Het
R3hdm2	G	A	10: 127,495,106	C818Y	probably damaging	Het
Rad51d	A	G	11: 82,889,998	V39A	possibly damaging	Het
Rptor	A	T	11: 119,872,367	T926S	probably benign	Het
Rwdd4a	G	A	8: 47,542,707	D41N	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Ssbp3	T	C	4: 107,046,388	S334P	probably damaging	Het
Suco	A	G	1: 161,876,305		probably benign	Het
Synj1	T	C	16: 90,964,631	K649R	possibly damaging	Het
Tdp2	C	T	13: 24,840,448	H243Y	possibly damaging	Het
Tinag	A	G	9: 76,996,882		probably benign	Het
Trerf1	T	C	17: 47,316,662		noncoding transcript	Het
Trip10	T	C	17: 57,262,349		probably benign	Het
Tsen54	A	T	11: 115,822,030	S131C	probably damaging	Het
Unc5c	A	T	3: 141,818,067	R794*	probably null	Het
Vmn2r59	A	T	7: 42,047,008	Y103*	probably null	Het
Washc5	A	G	15: 59,352,530	V460A	probably benign	Het
Whamm	A	G	7: 81,594,015	T358A	probably benign	Het
Xlr4b	C	T	X: 73,218,671		probably benign	Het
Zbbx	C	T	3: 75,085,562		probably benign	Het
Zdhhc23	G	A	16: 43,973,703	P203S	probably benign	Het
Zfp27	T	A	7: 29,896,425	E38D	possibly damaging	Het

Other mutations in Eprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00532:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00543:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00553:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00574:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00583:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00946:Eprs	APN	1	185407701	missense	probably benign	0.02
IGL01062:Eprs	APN	1	185379615	missense	probably benign	0.19
IGL01477:Eprs	APN	1	185411375	splice site	probably benign
IGL01608:Eprs	APN	1	185385114	unclassified	probably benign
IGL01767:Eprs	APN	1	185384915	missense	probably damaging	0.98
IGL02136:Eprs	APN	1	185384983	missense	probably damaging	1.00
IGL02302:Eprs	APN	1	185387124	splice site	probably benign
IGL02528:Eprs	APN	1	185413489	missense	probably damaging	1.00
IGL02631:Eprs	APN	1	185427898	missense	probably damaging	1.00
IGL02989:Eprs	APN	1	185418366	missense	probably benign	0.31
IGL03004:Eprs	APN	1	185381833	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0783:Eprs	UTSW	1	185398458	missense	probably damaging	1.00
R1319:Eprs	UTSW	1	185384962	missense	probably damaging	1.00
R1335:Eprs	UTSW	1	185387089	missense	probably damaging	1.00
R1514:Eprs	UTSW	1	185381834	missense	probably damaging	0.99
R1590:Eprs	UTSW	1	185401510	missense	probably damaging	1.00
R1688:Eprs	UTSW	1	185384896	missense	probably damaging	0.99
R1725:Eprs	UTSW	1	185406992	missense	probably damaging	1.00
R2182:Eprs	UTSW	1	185379742	splice site	probably null
R2228:Eprs	UTSW	1	185367537	missense	probably damaging	1.00
R2336:Eprs	UTSW	1	185411374	splice site	probably benign
R2338:Eprs	UTSW	1	185415808	missense	probably damaging	1.00
R2439:Eprs	UTSW	1	185379742	splice site	probably null
R2914:Eprs	UTSW	1	185379742	splice site	probably null
R3001:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3002:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3003:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3547:Eprs	UTSW	1	185379742	splice site	probably null
R3775:Eprs	UTSW	1	185373008	missense	probably damaging	1.00
R3878:Eprs	UTSW	1	185415953	critical splice donor site	probably null
R3902:Eprs	UTSW	1	185379742	splice site	probably null
R3913:Eprs	UTSW	1	185379742	splice site	probably null
R4579:Eprs	UTSW	1	185401607	missense	probably damaging	1.00
R4664:Eprs	UTSW	1	185373076	intron	probably benign
R4680:Eprs	UTSW	1	185386278	missense	possibly damaging	0.87
R4712:Eprs	UTSW	1	185428108	missense	probably benign	0.00
R4749:Eprs	UTSW	1	185396130	missense	probably damaging	0.97
R4995:Eprs	UTSW	1	185410139	intron	probably benign
R5154:Eprs	UTSW	1	185413465	missense	probably damaging	1.00
R5640:Eprs	UTSW	1	185374184	missense	probably benign	0.34
R5662:Eprs	UTSW	1	185394425	missense	possibly damaging	0.72
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6151:Eprs	UTSW	1	185407754	critical splice donor site	probably null
R6387:Eprs	UTSW	1	185387084	missense	possibly damaging	0.94
R6647:Eprs	UTSW	1	185414424	missense	probably damaging	1.00
R6701:Eprs	UTSW	1	185370890	missense	probably damaging	0.99
R6997:Eprs	UTSW	1	185396163	missense	possibly damaging	0.50
R7295:Eprs	UTSW	1	185418210	critical splice acceptor site	probably null
R7305:Eprs	UTSW	1	185379701	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACACACGCATACTTCATTTGTCACT -3'
(R):5'- TGCCTGAGCGATATACAGTAATCAGAGT -3'

Sequencing Primer
(F):5'- CACTGTGTTCTTCTCAGGATTTG -3'
(R):5'- acctcctgcctctaccac -3'

Posted On

2013-04-16