Mutagenetix > Incidental Mutations

Incidental Mutation 'R2083:Olfr26'

230150

Institutional Source

Beutler Lab

Gene Symbol

Olfr26

Ensembl Gene

ENSMUSG00000047667

Gene Name

olfactory receptor 26

Synonyms

MTPCR09, MOR171-9, GA_x6K02T2PVTD-32550930-32551856

MMRRC Submission

040088-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R2083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38855060-38855990 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 38855341 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 93 (V93G)

Ref Sequence

ENSEMBL: ENSMUSP00000100467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000104874] [ENSMUST00000217350]

Predicted Effect

probably benign
Transcript: ENSMUST00000104874
AA Change: V93G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000100467
Gene: ENSMUSG00000047667
AA Change: V93G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	3.8e-49	PFAM
Pfam:7tm_1	41	290	2.4e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217350

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	T	A	5: 146,184,871	M73L	possibly damaging	Het
AA986860	A	T	1: 130,741,069	I58F	probably damaging	Het
Acsl3	A	T	1: 78,699,811	K507N	probably damaging	Het
Adcy3	T	C	12: 4,173,512	Y245H	probably damaging	Het
Adgra1	T	C	7: 139,875,631	S392P	probably damaging	Het
Ahnak	C	T	19: 9,011,557	P3402S	probably damaging	Het
Ambra1	T	A	2: 91,766,600	I12N	possibly damaging	Het
Atp10b	A	G	11: 43,212,423	T545A	probably benign	Het
Atxn2	G	T	5: 121,784,006	A638S	probably benign	Het
Cd109	T	C	9: 78,667,293	S520P	probably damaging	Het
Col6a3	T	C	1: 90,782,011	D1821G	unknown	Het
Cyp4a10	T	C	4: 115,525,308	V265A	possibly damaging	Het
Dmrtb1	C	T	4: 107,683,612	R184Q	possibly damaging	Het
Dnah7b	A	T	1: 46,241,067	I2719F	possibly damaging	Het
En2	T	C	5: 28,167,073	S183P	probably damaging	Het
Etfb	A	G	7: 43,456,500	T101A	probably benign	Het
Etl4	T	A	2: 20,743,549	S364T	probably damaging	Het
Fam196b	A	G	11: 34,402,141	D61G	probably benign	Het
Gm17728	C	A	17: 9,422,289	S77Y	possibly damaging	Het
Golga4	A	G	9: 118,532,590	E221G	probably damaging	Het
Gpr37	T	C	6: 25,688,417	N227S	possibly damaging	Het
Kctd1	A	T	18: 14,974,055	N784K	possibly damaging	Het
Klhl22	A	G	16: 17,776,525	T173A	probably benign	Het
Ly6e	T	A	15: 74,958,319	C41S	probably damaging	Het
Mapkbp1	T	C	2: 120,015,482	L444P	possibly damaging	Het
Mkx	A	T	18: 6,992,855	I143K	probably damaging	Het
Mlh3	A	G	12: 85,269,041	F124L	probably benign	Het
Nlrp1a	A	T	11: 71,124,220	L68H	possibly damaging	Het
Obscn	A	C	11: 59,073,631	Y726*	probably null	Het
Olfr1312	C	T	2: 112,042,553	V160I	probably benign	Het
Peak1	G	A	9: 56,258,949	S565L	probably damaging	Het
Pter	T	A	2: 12,978,436	L84Q	probably damaging	Het
Ptpn4	A	G	1: 119,687,759	L555P	possibly damaging	Het
Rpp40	A	T	13: 35,898,992	M171K	probably benign	Het
Sacs	A	G	14: 61,206,506	I2000M	possibly damaging	Het
Scn5a	T	C	9: 119,492,123	I1458V	probably benign	Het
Slc38a4	T	C	15: 97,008,993	D288G	probably benign	Het
Slc8a2	T	G	7: 16,134,515	V224G	probably damaging	Het
Sptbn4	T	C	7: 27,428,256	E173G	probably benign	Het
Tas1r1	T	A	4: 152,028,391	H735L	probably benign	Het
Trps1	G	T	15: 50,822,305	Q155K	probably damaging	Het
Tspyl5	T	C	15: 33,686,746	H351R	probably damaging	Het
Ttf2	A	T	3: 100,969,501	D21E	probably benign	Het
Ttll7	A	G	3: 146,930,104	R398G	possibly damaging	Het
Tubgcp6	A	T	15: 89,122,376	Y148N	probably damaging	Het
Vmn1r8	T	A	6: 57,036,340	H125Q	probably benign	Het
Zfhx4	A	G	3: 5,403,163	T2794A	possibly damaging	Het
Zfp27	T	C	7: 29,894,783	I586V	probably benign	Het
Zfyve16	T	C	13: 92,524,262	D13G	probably damaging	Het

Other mutations in Olfr26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01518:Olfr26	APN	9	38855799	missense	probably benign	0.00
IGL01909:Olfr26	APN	9	38855717	nonsense	probably null
IGL02146:Olfr26	APN	9	38855358	missense	probably benign	0.01
IGL02229:Olfr26	APN	9	38855416	missense	possibly damaging	0.62
IGL02382:Olfr26	APN	9	38855068	missense	probably benign
IGL03007:Olfr26	APN	9	38855296	missense	probably damaging	1.00
IGL03118:Olfr26	APN	9	38855230	missense	probably damaging	1.00
PIT4403001:Olfr26	UTSW	9	38855380	missense	probably benign	0.39
R0590:Olfr26	UTSW	9	38855470	missense	probably damaging	0.99
R0862:Olfr26	UTSW	9	38855182	missense	possibly damaging	0.89
R1779:Olfr26	UTSW	9	38855550	missense	possibly damaging	0.55
R1796:Olfr26	UTSW	9	38855524	missense	probably benign	0.01
R3420:Olfr26	UTSW	9	38855325	missense	possibly damaging	0.92
R3421:Olfr26	UTSW	9	38855325	missense	possibly damaging	0.92
R4328:Olfr26	UTSW	9	38855836	missense	possibly damaging	0.62
R4470:Olfr26	UTSW	9	38855631	missense	probably damaging	1.00
R4471:Olfr26	UTSW	9	38855631	missense	probably damaging	1.00
R5047:Olfr26	UTSW	9	38855289	missense	probably benign	0.36
R5267:Olfr26	UTSW	9	38855805	missense	probably damaging	1.00
R5318:Olfr26	UTSW	9	38855448	missense	probably damaging	1.00
R6502:Olfr26	UTSW	9	38855637	missense	probably damaging	0.99
R7221:Olfr26	UTSW	9	38855242	missense	probably damaging	1.00
R7297:Olfr26	UTSW	9	38855949	missense	probably damaging	1.00
R7448:Olfr26	UTSW	9	38855116	missense	probably damaging	1.00
R7525:Olfr26	UTSW	9	38855238	missense	possibly damaging	0.89
R8040:Olfr26	UTSW	9	38855164	missense	probably damaging	0.99
R8303:Olfr26	UTSW	9	38855541	missense	probably damaging	1.00
Z1177:Olfr26	UTSW	9	38855235	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGGGCATCTATGTGGTAAC -3'
(R):5'- AGCTCAGATTCATCATAGCACTTG -3'

Sequencing Primer
(F):5'- TGGTAACAGCAGTGGGAAAC -3'
(R):5'- CAGATTCATCATAGCACTTGTGTGTG -3'

Posted On

2014-09-18