Incidental Mutation 'R2083:Or8d1'
ID 230150
Institutional Source Beutler Lab
Gene Symbol Or8d1
Ensembl Gene ENSMUSG00000047667
Gene Name olfactory receptor family 8 subfamily D member 1
Synonyms GA_x6K02T2PVTD-32550930-32551856, MOR171-9, MTPCR09, Olfr26
MMRRC Submission 040088-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38766356-38767286 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 38766637 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 93 (V93G)
Ref Sequence ENSEMBL: ENSMUSP00000100467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104874] [ENSMUST00000217350]
AlphaFold Q7TRB7
Predicted Effect probably benign
Transcript: ENSMUST00000104874
AA Change: V93G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100467
Gene: ENSMUSG00000047667
AA Change: V93G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 2.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217350
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,121,681 (GRCm39) M73L possibly damaging Het
AA986860 A T 1: 130,668,806 (GRCm39) I58F probably damaging Het
Acsl3 A T 1: 78,677,528 (GRCm39) K507N probably damaging Het
Adcy3 T C 12: 4,223,512 (GRCm39) Y245H probably damaging Het
Adgra1 T C 7: 139,455,547 (GRCm39) S392P probably damaging Het
Ahnak C T 19: 8,988,921 (GRCm39) P3402S probably damaging Het
Ambra1 T A 2: 91,596,945 (GRCm39) I12N possibly damaging Het
Atp10b A G 11: 43,103,250 (GRCm39) T545A probably benign Het
Atxn2 G T 5: 121,922,069 (GRCm39) A638S probably benign Het
Cd109 T C 9: 78,574,575 (GRCm39) S520P probably damaging Het
Col6a3 T C 1: 90,709,733 (GRCm39) D1821G unknown Het
Cyp4a10 T C 4: 115,382,505 (GRCm39) V265A possibly damaging Het
Dmrtb1 C T 4: 107,540,809 (GRCm39) R184Q possibly damaging Het
Dnah7b A T 1: 46,280,227 (GRCm39) I2719F possibly damaging Het
En2 T C 5: 28,372,071 (GRCm39) S183P probably damaging Het
Etfb A G 7: 43,105,924 (GRCm39) T101A probably benign Het
Etl4 T A 2: 20,748,360 (GRCm39) S364T probably damaging Het
Gm17728 C A 17: 9,641,121 (GRCm39) S77Y possibly damaging Het
Golga4 A G 9: 118,361,658 (GRCm39) E221G probably damaging Het
Gpr37 T C 6: 25,688,416 (GRCm39) N227S possibly damaging Het
Insyn2b A G 11: 34,352,141 (GRCm39) D61G probably benign Het
Kctd1 A T 18: 15,107,112 (GRCm39) N784K possibly damaging Het
Klhl22 A G 16: 17,594,389 (GRCm39) T173A probably benign Het
Ly6e T A 15: 74,830,168 (GRCm39) C41S probably damaging Het
Mapkbp1 T C 2: 119,845,963 (GRCm39) L444P possibly damaging Het
Mkx A T 18: 6,992,855 (GRCm39) I143K probably damaging Het
Mlh3 A G 12: 85,315,815 (GRCm39) F124L probably benign Het
Nlrp1a A T 11: 71,015,046 (GRCm39) L68H possibly damaging Het
Obscn A C 11: 58,964,457 (GRCm39) Y726* probably null Het
Or4f59 C T 2: 111,872,898 (GRCm39) V160I probably benign Het
Peak1 G A 9: 56,166,233 (GRCm39) S565L probably damaging Het
Pter T A 2: 12,983,247 (GRCm39) L84Q probably damaging Het
Ptpn4 A G 1: 119,615,489 (GRCm39) L555P possibly damaging Het
Rpp40 A T 13: 36,082,975 (GRCm39) M171K probably benign Het
Sacs A G 14: 61,443,955 (GRCm39) I2000M possibly damaging Het
Scn5a T C 9: 119,321,189 (GRCm39) I1458V probably benign Het
Slc38a4 T C 15: 96,906,874 (GRCm39) D288G probably benign Het
Slc8a2 T G 7: 15,868,440 (GRCm39) V224G probably damaging Het
Sptbn4 T C 7: 27,127,681 (GRCm39) E173G probably benign Het
Tas1r1 T A 4: 152,112,848 (GRCm39) H735L probably benign Het
Trps1 G T 15: 50,685,701 (GRCm39) Q155K probably damaging Het
Tspyl5 T C 15: 33,686,892 (GRCm39) H351R probably damaging Het
Ttf2 A T 3: 100,876,817 (GRCm39) D21E probably benign Het
Ttll7 A G 3: 146,635,859 (GRCm39) R398G possibly damaging Het
Tubgcp6 A T 15: 89,006,579 (GRCm39) Y148N probably damaging Het
Vmn1r8 T A 6: 57,013,325 (GRCm39) H125Q probably benign Het
Zfhx4 A G 3: 5,468,223 (GRCm39) T2794A possibly damaging Het
Zfp27 T C 7: 29,594,208 (GRCm39) I586V probably benign Het
Zfyve16 T C 13: 92,660,770 (GRCm39) D13G probably damaging Het
Other mutations in Or8d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Or8d1 APN 9 38,767,095 (GRCm39) missense probably benign 0.00
IGL01909:Or8d1 APN 9 38,767,013 (GRCm39) nonsense probably null
IGL02146:Or8d1 APN 9 38,766,654 (GRCm39) missense probably benign 0.01
IGL02229:Or8d1 APN 9 38,766,712 (GRCm39) missense possibly damaging 0.62
IGL02382:Or8d1 APN 9 38,766,364 (GRCm39) missense probably benign
IGL03007:Or8d1 APN 9 38,766,592 (GRCm39) missense probably damaging 1.00
IGL03118:Or8d1 APN 9 38,766,526 (GRCm39) missense probably damaging 1.00
PIT4403001:Or8d1 UTSW 9 38,766,676 (GRCm39) missense probably benign 0.39
R0590:Or8d1 UTSW 9 38,766,766 (GRCm39) missense probably damaging 0.99
R0862:Or8d1 UTSW 9 38,766,478 (GRCm39) missense possibly damaging 0.89
R1779:Or8d1 UTSW 9 38,766,846 (GRCm39) missense possibly damaging 0.55
R1796:Or8d1 UTSW 9 38,766,820 (GRCm39) missense probably benign 0.01
R3420:Or8d1 UTSW 9 38,766,621 (GRCm39) missense possibly damaging 0.92
R3421:Or8d1 UTSW 9 38,766,621 (GRCm39) missense possibly damaging 0.92
R4328:Or8d1 UTSW 9 38,767,132 (GRCm39) missense possibly damaging 0.62
R4470:Or8d1 UTSW 9 38,766,927 (GRCm39) missense probably damaging 1.00
R4471:Or8d1 UTSW 9 38,766,927 (GRCm39) missense probably damaging 1.00
R5047:Or8d1 UTSW 9 38,766,585 (GRCm39) missense probably benign 0.36
R5267:Or8d1 UTSW 9 38,767,101 (GRCm39) missense probably damaging 1.00
R5318:Or8d1 UTSW 9 38,766,744 (GRCm39) missense probably damaging 1.00
R6502:Or8d1 UTSW 9 38,766,933 (GRCm39) missense probably damaging 0.99
R7221:Or8d1 UTSW 9 38,766,538 (GRCm39) missense probably damaging 1.00
R7297:Or8d1 UTSW 9 38,767,245 (GRCm39) missense probably damaging 1.00
R7448:Or8d1 UTSW 9 38,766,412 (GRCm39) missense probably damaging 1.00
R7525:Or8d1 UTSW 9 38,766,534 (GRCm39) missense possibly damaging 0.89
R8040:Or8d1 UTSW 9 38,766,460 (GRCm39) missense probably damaging 0.99
R8303:Or8d1 UTSW 9 38,766,837 (GRCm39) missense probably damaging 1.00
R8972:Or8d1 UTSW 9 38,767,254 (GRCm39) missense probably damaging 1.00
Z1177:Or8d1 UTSW 9 38,766,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGGCATCTATGTGGTAAC -3'
(R):5'- AGCTCAGATTCATCATAGCACTTG -3'

Sequencing Primer
(F):5'- TGGTAACAGCAGTGGGAAAC -3'
(R):5'- CAGATTCATCATAGCACTTGTGTGTG -3'
Posted On 2014-09-18