Incidental Mutation 'R2083:Cd109'
ID 230152
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene Name CD109 antigen
Synonyms Gov platelet alloantigens, 9930012E15Rik
MMRRC Submission 040088-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 78522828-78623535 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78574575 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 520 (S520P)
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
AlphaFold Q8R422
Predicted Effect probably damaging
Transcript: ENSMUST00000093812
AA Change: S520P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186
AA Change: S520P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,121,681 (GRCm39) M73L possibly damaging Het
AA986860 A T 1: 130,668,806 (GRCm39) I58F probably damaging Het
Acsl3 A T 1: 78,677,528 (GRCm39) K507N probably damaging Het
Adcy3 T C 12: 4,223,512 (GRCm39) Y245H probably damaging Het
Adgra1 T C 7: 139,455,547 (GRCm39) S392P probably damaging Het
Ahnak C T 19: 8,988,921 (GRCm39) P3402S probably damaging Het
Ambra1 T A 2: 91,596,945 (GRCm39) I12N possibly damaging Het
Atp10b A G 11: 43,103,250 (GRCm39) T545A probably benign Het
Atxn2 G T 5: 121,922,069 (GRCm39) A638S probably benign Het
Col6a3 T C 1: 90,709,733 (GRCm39) D1821G unknown Het
Cyp4a10 T C 4: 115,382,505 (GRCm39) V265A possibly damaging Het
Dmrtb1 C T 4: 107,540,809 (GRCm39) R184Q possibly damaging Het
Dnah7b A T 1: 46,280,227 (GRCm39) I2719F possibly damaging Het
En2 T C 5: 28,372,071 (GRCm39) S183P probably damaging Het
Etfb A G 7: 43,105,924 (GRCm39) T101A probably benign Het
Etl4 T A 2: 20,748,360 (GRCm39) S364T probably damaging Het
Gm17728 C A 17: 9,641,121 (GRCm39) S77Y possibly damaging Het
Golga4 A G 9: 118,361,658 (GRCm39) E221G probably damaging Het
Gpr37 T C 6: 25,688,416 (GRCm39) N227S possibly damaging Het
Insyn2b A G 11: 34,352,141 (GRCm39) D61G probably benign Het
Kctd1 A T 18: 15,107,112 (GRCm39) N784K possibly damaging Het
Klhl22 A G 16: 17,594,389 (GRCm39) T173A probably benign Het
Ly6e T A 15: 74,830,168 (GRCm39) C41S probably damaging Het
Mapkbp1 T C 2: 119,845,963 (GRCm39) L444P possibly damaging Het
Mkx A T 18: 6,992,855 (GRCm39) I143K probably damaging Het
Mlh3 A G 12: 85,315,815 (GRCm39) F124L probably benign Het
Nlrp1a A T 11: 71,015,046 (GRCm39) L68H possibly damaging Het
Obscn A C 11: 58,964,457 (GRCm39) Y726* probably null Het
Or4f59 C T 2: 111,872,898 (GRCm39) V160I probably benign Het
Or8d1 T G 9: 38,766,637 (GRCm39) V93G probably benign Het
Peak1 G A 9: 56,166,233 (GRCm39) S565L probably damaging Het
Pter T A 2: 12,983,247 (GRCm39) L84Q probably damaging Het
Ptpn4 A G 1: 119,615,489 (GRCm39) L555P possibly damaging Het
Rpp40 A T 13: 36,082,975 (GRCm39) M171K probably benign Het
Sacs A G 14: 61,443,955 (GRCm39) I2000M possibly damaging Het
Scn5a T C 9: 119,321,189 (GRCm39) I1458V probably benign Het
Slc38a4 T C 15: 96,906,874 (GRCm39) D288G probably benign Het
Slc8a2 T G 7: 15,868,440 (GRCm39) V224G probably damaging Het
Sptbn4 T C 7: 27,127,681 (GRCm39) E173G probably benign Het
Tas1r1 T A 4: 152,112,848 (GRCm39) H735L probably benign Het
Trps1 G T 15: 50,685,701 (GRCm39) Q155K probably damaging Het
Tspyl5 T C 15: 33,686,892 (GRCm39) H351R probably damaging Het
Ttf2 A T 3: 100,876,817 (GRCm39) D21E probably benign Het
Ttll7 A G 3: 146,635,859 (GRCm39) R398G possibly damaging Het
Tubgcp6 A T 15: 89,006,579 (GRCm39) Y148N probably damaging Het
Vmn1r8 T A 6: 57,013,325 (GRCm39) H125Q probably benign Het
Zfhx4 A G 3: 5,468,223 (GRCm39) T2794A possibly damaging Het
Zfp27 T C 7: 29,594,208 (GRCm39) I586V probably benign Het
Zfyve16 T C 13: 92,660,770 (GRCm39) D13G probably damaging Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78,524,251 (GRCm39) missense probably damaging 1.00
IGL00465:Cd109 APN 9 78,568,216 (GRCm39) nonsense probably null
IGL00667:Cd109 APN 9 78,592,159 (GRCm39) missense probably damaging 0.99
IGL01432:Cd109 APN 9 78,605,405 (GRCm39) missense probably benign
IGL01795:Cd109 APN 9 78,569,047 (GRCm39) splice site probably benign
IGL02343:Cd109 APN 9 78,596,237 (GRCm39) splice site probably benign
IGL02450:Cd109 APN 9 78,603,132 (GRCm39) missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78,579,271 (GRCm39) splice site probably benign
IGL02738:Cd109 APN 9 78,598,581 (GRCm39) missense probably damaging 1.00
IGL02797:Cd109 APN 9 78,568,995 (GRCm39) missense probably damaging 0.96
IGL03160:Cd109 APN 9 78,568,338 (GRCm39) splice site probably null
IGL03349:Cd109 APN 9 78,543,767 (GRCm39) missense probably benign 0.34
FR4589:Cd109 UTSW 9 78,619,811 (GRCm39) critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78,587,303 (GRCm39) missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78,610,389 (GRCm39) missense probably damaging 1.00
R0060:Cd109 UTSW 9 78,610,389 (GRCm39) missense probably damaging 1.00
R0158:Cd109 UTSW 9 78,596,214 (GRCm39) missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78,619,897 (GRCm39) missense probably benign 0.13
R0659:Cd109 UTSW 9 78,587,452 (GRCm39) splice site probably benign
R0709:Cd109 UTSW 9 78,579,260 (GRCm39) missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78,571,612 (GRCm39) missense probably benign 0.04
R0909:Cd109 UTSW 9 78,543,755 (GRCm39) missense probably benign 0.01
R0945:Cd109 UTSW 9 78,596,223 (GRCm39) missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78,579,832 (GRCm39) critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78,561,869 (GRCm39) missense probably damaging 1.00
R1484:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78,612,373 (GRCm39) missense probably benign 0.17
R1773:Cd109 UTSW 9 78,611,006 (GRCm39) missense probably benign 0.21
R1813:Cd109 UTSW 9 78,524,287 (GRCm39) missense probably benign 0.04
R2004:Cd109 UTSW 9 78,611,044 (GRCm39) missense probably benign 0.00
R2483:Cd109 UTSW 9 78,574,639 (GRCm39) missense probably damaging 1.00
R2857:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2859:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78,574,639 (GRCm39) missense probably damaging 1.00
R3713:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3762:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3773:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3916:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78,543,745 (GRCm39) missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78,579,871 (GRCm39) missense probably benign 0.00
R4723:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78,541,959 (GRCm39) critical splice donor site probably null
R5259:Cd109 UTSW 9 78,617,434 (GRCm39) missense probably benign 0.30
R5353:Cd109 UTSW 9 78,617,521 (GRCm39) missense probably damaging 1.00
R5440:Cd109 UTSW 9 78,587,446 (GRCm39) critical splice donor site probably null
R5559:Cd109 UTSW 9 78,568,250 (GRCm39) missense probably benign 0.01
R5701:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78,607,561 (GRCm39) missense probably benign 0.01
R5997:Cd109 UTSW 9 78,612,344 (GRCm39) missense possibly damaging 0.93
R6103:Cd109 UTSW 9 78,605,596 (GRCm39) splice site probably null
R6174:Cd109 UTSW 9 78,572,828 (GRCm39) critical splice donor site probably null
R6410:Cd109 UTSW 9 78,564,798 (GRCm39) missense probably benign 0.01
R6529:Cd109 UTSW 9 78,619,907 (GRCm39) missense probably damaging 1.00
R6655:Cd109 UTSW 9 78,592,220 (GRCm39) missense probably benign 0.44
R6704:Cd109 UTSW 9 78,587,357 (GRCm39) missense probably benign 0.01
R6772:Cd109 UTSW 9 78,588,092 (GRCm39) missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78,622,237 (GRCm39) missense probably benign 0.01
R6903:Cd109 UTSW 9 78,543,885 (GRCm39) missense probably damaging 0.97
R7294:Cd109 UTSW 9 78,619,917 (GRCm39) missense probably damaging 0.97
R7432:Cd109 UTSW 9 78,622,225 (GRCm39) missense possibly damaging 0.85
R7566:Cd109 UTSW 9 78,588,119 (GRCm39) missense probably damaging 1.00
R7767:Cd109 UTSW 9 78,617,441 (GRCm39) missense probably damaging 1.00
R7986:Cd109 UTSW 9 78,596,048 (GRCm39) missense possibly damaging 0.95
R8017:Cd109 UTSW 9 78,614,828 (GRCm39) missense possibly damaging 0.81
R8019:Cd109 UTSW 9 78,614,828 (GRCm39) missense possibly damaging 0.81
R8050:Cd109 UTSW 9 78,571,633 (GRCm39) missense probably benign 0.28
R8225:Cd109 UTSW 9 78,568,972 (GRCm39) missense probably damaging 0.99
R8269:Cd109 UTSW 9 78,572,964 (GRCm39) missense probably benign 0.06
R8479:Cd109 UTSW 9 78,574,628 (GRCm39) nonsense probably null
R8493:Cd109 UTSW 9 78,564,801 (GRCm39) missense probably benign 0.41
R8781:Cd109 UTSW 9 78,543,929 (GRCm39) missense probably damaging 1.00
R8977:Cd109 UTSW 9 78,614,810 (GRCm39) missense probably benign 0.36
R9051:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
R9051:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R9228:Cd109 UTSW 9 78,577,042 (GRCm39) missense possibly damaging 0.93
R9366:Cd109 UTSW 9 78,622,275 (GRCm39) missense probably benign 0.11
R9430:Cd109 UTSW 9 78,574,698 (GRCm39) critical splice donor site probably null
R9572:Cd109 UTSW 9 78,567,588 (GRCm39) missense probably benign 0.16
R9691:Cd109 UTSW 9 78,611,074 (GRCm39) missense possibly damaging 0.94
R9736:Cd109 UTSW 9 78,619,918 (GRCm39) missense probably damaging 1.00
R9749:Cd109 UTSW 9 78,592,166 (GRCm39) missense probably damaging 1.00
R9751:Cd109 UTSW 9 78,605,442 (GRCm39) missense probably damaging 0.99
R9752:Cd109 UTSW 9 78,614,834 (GRCm39) missense probably benign 0.00
R9789:Cd109 UTSW 9 78,541,944 (GRCm39) missense possibly damaging 0.90
R9797:Cd109 UTSW 9 78,579,217 (GRCm39) missense probably benign 0.04
RF002:Cd109 UTSW 9 78,619,810 (GRCm39) critical splice acceptor site probably benign
RF002:Cd109 UTSW 9 78,619,805 (GRCm39) critical splice acceptor site probably benign
RF003:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
RF011:Cd109 UTSW 9 78,619,810 (GRCm39) critical splice acceptor site probably benign
RF013:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
RF047:Cd109 UTSW 9 78,619,809 (GRCm39) critical splice acceptor site probably benign
RF060:Cd109 UTSW 9 78,619,807 (GRCm39) critical splice acceptor site probably benign
Z1177:Cd109 UTSW 9 78,598,595 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCTGTAAAGAGGTTGTGAAG -3'
(R):5'- TCCCAGCAATGTGGATAACTGATTC -3'

Sequencing Primer
(F):5'- CCTGTAAAGAGGTTGTGAAGATAAC -3'
(R):5'- GCAATGTGGATAACTGATTCTTCTGC -3'
Posted On 2014-09-18