Incidental Mutation 'R2083:Atp10b'
ID 230156
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene Name ATPase, class V, type 10B
Synonyms 9030605H24Rik, 5930426O13Rik
MMRRC Submission 040088-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 43040704-43153112 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43103250 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 545 (T545A)
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
AlphaFold B1AWN4
Predicted Effect probably benign
Transcript: ENSMUST00000077659
AA Change: T545A

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: T545A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127604
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,121,681 (GRCm39) M73L possibly damaging Het
AA986860 A T 1: 130,668,806 (GRCm39) I58F probably damaging Het
Acsl3 A T 1: 78,677,528 (GRCm39) K507N probably damaging Het
Adcy3 T C 12: 4,223,512 (GRCm39) Y245H probably damaging Het
Adgra1 T C 7: 139,455,547 (GRCm39) S392P probably damaging Het
Ahnak C T 19: 8,988,921 (GRCm39) P3402S probably damaging Het
Ambra1 T A 2: 91,596,945 (GRCm39) I12N possibly damaging Het
Atxn2 G T 5: 121,922,069 (GRCm39) A638S probably benign Het
Cd109 T C 9: 78,574,575 (GRCm39) S520P probably damaging Het
Col6a3 T C 1: 90,709,733 (GRCm39) D1821G unknown Het
Cyp4a10 T C 4: 115,382,505 (GRCm39) V265A possibly damaging Het
Dmrtb1 C T 4: 107,540,809 (GRCm39) R184Q possibly damaging Het
Dnah7b A T 1: 46,280,227 (GRCm39) I2719F possibly damaging Het
En2 T C 5: 28,372,071 (GRCm39) S183P probably damaging Het
Etfb A G 7: 43,105,924 (GRCm39) T101A probably benign Het
Etl4 T A 2: 20,748,360 (GRCm39) S364T probably damaging Het
Gm17728 C A 17: 9,641,121 (GRCm39) S77Y possibly damaging Het
Golga4 A G 9: 118,361,658 (GRCm39) E221G probably damaging Het
Gpr37 T C 6: 25,688,416 (GRCm39) N227S possibly damaging Het
Insyn2b A G 11: 34,352,141 (GRCm39) D61G probably benign Het
Kctd1 A T 18: 15,107,112 (GRCm39) N784K possibly damaging Het
Klhl22 A G 16: 17,594,389 (GRCm39) T173A probably benign Het
Ly6e T A 15: 74,830,168 (GRCm39) C41S probably damaging Het
Mapkbp1 T C 2: 119,845,963 (GRCm39) L444P possibly damaging Het
Mkx A T 18: 6,992,855 (GRCm39) I143K probably damaging Het
Mlh3 A G 12: 85,315,815 (GRCm39) F124L probably benign Het
Nlrp1a A T 11: 71,015,046 (GRCm39) L68H possibly damaging Het
Obscn A C 11: 58,964,457 (GRCm39) Y726* probably null Het
Or4f59 C T 2: 111,872,898 (GRCm39) V160I probably benign Het
Or8d1 T G 9: 38,766,637 (GRCm39) V93G probably benign Het
Peak1 G A 9: 56,166,233 (GRCm39) S565L probably damaging Het
Pter T A 2: 12,983,247 (GRCm39) L84Q probably damaging Het
Ptpn4 A G 1: 119,615,489 (GRCm39) L555P possibly damaging Het
Rpp40 A T 13: 36,082,975 (GRCm39) M171K probably benign Het
Sacs A G 14: 61,443,955 (GRCm39) I2000M possibly damaging Het
Scn5a T C 9: 119,321,189 (GRCm39) I1458V probably benign Het
Slc38a4 T C 15: 96,906,874 (GRCm39) D288G probably benign Het
Slc8a2 T G 7: 15,868,440 (GRCm39) V224G probably damaging Het
Sptbn4 T C 7: 27,127,681 (GRCm39) E173G probably benign Het
Tas1r1 T A 4: 152,112,848 (GRCm39) H735L probably benign Het
Trps1 G T 15: 50,685,701 (GRCm39) Q155K probably damaging Het
Tspyl5 T C 15: 33,686,892 (GRCm39) H351R probably damaging Het
Ttf2 A T 3: 100,876,817 (GRCm39) D21E probably benign Het
Ttll7 A G 3: 146,635,859 (GRCm39) R398G possibly damaging Het
Tubgcp6 A T 15: 89,006,579 (GRCm39) Y148N probably damaging Het
Vmn1r8 T A 6: 57,013,325 (GRCm39) H125Q probably benign Het
Zfhx4 A G 3: 5,468,223 (GRCm39) T2794A possibly damaging Het
Zfp27 T C 7: 29,594,208 (GRCm39) I586V probably benign Het
Zfyve16 T C 13: 92,660,770 (GRCm39) D13G probably damaging Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43,092,988 (GRCm39) missense probably damaging 1.00
IGL01385:Atp10b APN 11 43,125,256 (GRCm39) missense probably damaging 1.00
IGL01524:Atp10b APN 11 43,150,672 (GRCm39) missense probably benign 0.18
IGL01575:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01588:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01590:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01832:Atp10b APN 11 43,125,262 (GRCm39) missense probably damaging 0.98
IGL01927:Atp10b APN 11 43,150,231 (GRCm39) splice site probably benign
IGL01933:Atp10b APN 11 43,085,457 (GRCm39) missense probably damaging 1.00
IGL02182:Atp10b APN 11 43,139,774 (GRCm39) missense probably damaging 1.00
IGL02215:Atp10b APN 11 43,085,492 (GRCm39) critical splice donor site probably null
IGL02216:Atp10b APN 11 43,150,616 (GRCm39) missense probably damaging 0.98
IGL02973:Atp10b APN 11 43,088,336 (GRCm39) missense probably damaging 1.00
IGL03012:Atp10b APN 11 43,085,482 (GRCm39) missense probably damaging 0.99
IGL03106:Atp10b APN 11 43,138,304 (GRCm39) missense probably benign 0.32
IGL03123:Atp10b APN 11 43,044,110 (GRCm39) missense probably benign 0.01
IGL03202:Atp10b APN 11 43,125,268 (GRCm39) critical splice donor site probably null
IGL03339:Atp10b APN 11 43,121,442 (GRCm39) missense probably null 0.71
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0281:Atp10b UTSW 11 43,044,131 (GRCm39) missense probably benign 0.00
R0379:Atp10b UTSW 11 43,145,141 (GRCm39) missense probably benign 0.05
R0380:Atp10b UTSW 11 43,116,424 (GRCm39) missense probably damaging 1.00
R0470:Atp10b UTSW 11 43,093,866 (GRCm39) missense possibly damaging 0.88
R1355:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1368:Atp10b UTSW 11 43,092,981 (GRCm39) missense probably damaging 1.00
R1370:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1413:Atp10b UTSW 11 43,121,391 (GRCm39) missense probably benign 0.00
R1502:Atp10b UTSW 11 43,121,174 (GRCm39) missense probably damaging 1.00
R1530:Atp10b UTSW 11 43,088,351 (GRCm39) missense probably benign 0.03
R1596:Atp10b UTSW 11 43,126,594 (GRCm39) missense probably damaging 1.00
R1675:Atp10b UTSW 11 43,116,475 (GRCm39) missense probably damaging 1.00
R1880:Atp10b UTSW 11 43,150,259 (GRCm39) missense probably damaging 1.00
R1938:Atp10b UTSW 11 43,121,245 (GRCm39) missense probably benign 0.00
R1986:Atp10b UTSW 11 43,063,595 (GRCm39) missense probably benign 0.12
R2081:Atp10b UTSW 11 43,092,955 (GRCm39) missense probably damaging 1.00
R2159:Atp10b UTSW 11 43,042,680 (GRCm39) missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43,125,207 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,080,440 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,063,572 (GRCm39) missense probably damaging 1.00
R3741:Atp10b UTSW 11 43,126,489 (GRCm39) missense probably damaging 1.00
R3942:Atp10b UTSW 11 43,063,581 (GRCm39) missense probably damaging 1.00
R3971:Atp10b UTSW 11 43,107,339 (GRCm39) missense probably damaging 1.00
R4007:Atp10b UTSW 11 43,150,679 (GRCm39) missense probably benign 0.04
R4050:Atp10b UTSW 11 43,150,363 (GRCm39) missense probably benign 0.00
R4078:Atp10b UTSW 11 43,044,110 (GRCm39) missense probably benign 0.01
R4567:Atp10b UTSW 11 43,088,384 (GRCm39) missense probably benign 0.03
R4651:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4652:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4667:Atp10b UTSW 11 43,138,345 (GRCm39) missense probably damaging 1.00
R4720:Atp10b UTSW 11 43,093,949 (GRCm39) missense probably benign
R4987:Atp10b UTSW 11 43,042,440 (GRCm39) utr 5 prime probably benign
R5232:Atp10b UTSW 11 43,093,006 (GRCm39) missense probably damaging 1.00
R5233:Atp10b UTSW 11 43,121,387 (GRCm39) missense probably benign 0.06
R5281:Atp10b UTSW 11 43,145,163 (GRCm39) missense probably damaging 0.97
R5307:Atp10b UTSW 11 43,103,302 (GRCm39) missense probably damaging 1.00
R5460:Atp10b UTSW 11 43,121,282 (GRCm39) missense probably benign 0.00
R5518:Atp10b UTSW 11 43,042,463 (GRCm39) missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43,136,252 (GRCm39) missense probably damaging 1.00
R5688:Atp10b UTSW 11 43,092,000 (GRCm39) missense probably benign 0.00
R5735:Atp10b UTSW 11 43,042,601 (GRCm39) missense probably benign 0.00
R6153:Atp10b UTSW 11 43,145,109 (GRCm39) missense probably damaging 1.00
R6251:Atp10b UTSW 11 43,126,573 (GRCm39) missense possibly damaging 0.95
R6259:Atp10b UTSW 11 43,092,065 (GRCm39) missense probably benign 0.24
R6394:Atp10b UTSW 11 43,116,464 (GRCm39) missense probably damaging 1.00
R6492:Atp10b UTSW 11 43,109,784 (GRCm39) missense probably damaging 1.00
R6769:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6771:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6775:Atp10b UTSW 11 43,113,040 (GRCm39) missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43,136,291 (GRCm39) missense probably damaging 1.00
R7322:Atp10b UTSW 11 43,103,374 (GRCm39) missense probably damaging 1.00
R7367:Atp10b UTSW 11 43,138,328 (GRCm39) missense probably damaging 1.00
R7538:Atp10b UTSW 11 43,116,373 (GRCm39) missense probably benign 0.04
R7708:Atp10b UTSW 11 43,092,970 (GRCm39) missense probably damaging 1.00
R7787:Atp10b UTSW 11 43,150,700 (GRCm39) missense possibly damaging 0.91
R8145:Atp10b UTSW 11 43,092,949 (GRCm39) missense probably damaging 1.00
R8406:Atp10b UTSW 11 43,093,984 (GRCm39) missense probably benign 0.00
R8503:Atp10b UTSW 11 43,113,066 (GRCm39) missense possibly damaging 0.92
R8542:Atp10b UTSW 11 43,121,208 (GRCm39) missense probably benign 0.18
R8744:Atp10b UTSW 11 43,121,177 (GRCm39) missense probably damaging 1.00
R8815:Atp10b UTSW 11 43,093,978 (GRCm39) missense possibly damaging 0.63
R8833:Atp10b UTSW 11 43,112,986 (GRCm39) missense probably damaging 1.00
R8880:Atp10b UTSW 11 43,106,811 (GRCm39) missense probably benign
R8989:Atp10b UTSW 11 43,136,269 (GRCm39) nonsense probably null
R8998:Atp10b UTSW 11 43,150,726 (GRCm39) makesense probably null
R9255:Atp10b UTSW 11 43,107,148 (GRCm39) missense probably damaging 1.00
R9281:Atp10b UTSW 11 43,116,458 (GRCm39) missense probably benign 0.11
R9345:Atp10b UTSW 11 43,094,024 (GRCm39) missense probably damaging 0.99
R9357:Atp10b UTSW 11 43,150,711 (GRCm39) missense probably benign 0.18
R9393:Atp10b UTSW 11 43,063,608 (GRCm39) missense probably damaging 1.00
R9516:Atp10b UTSW 11 43,121,224 (GRCm39) missense probably benign 0.02
R9644:Atp10b UTSW 11 43,042,659 (GRCm39) missense probably damaging 1.00
R9747:Atp10b UTSW 11 43,088,339 (GRCm39) missense probably benign
Z1177:Atp10b UTSW 11 43,044,176 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCAGTTGCAGGGAGGAATG -3'
(R):5'- GCCTTTCTGATCAGGGATTTCC -3'

Sequencing Primer
(F):5'- TGCAGGGAGGAATGTGCTG -3'
(R):5'- AATCATCACTCCACCTTACCCTC -3'
Posted On 2014-09-18