Mutagenetix > Incidental Mutation

Incidental Mutation 'R2083:Atp10b'

230156

Institutional Source

Beutler Lab

Gene Symbol

Atp10b

Ensembl Gene

ENSMUSG00000055415

Gene Name

ATPase, class V, type 10B

Synonyms

5930426O13Rik, 9030605H24Rik

MMRRC Submission

040088-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R2083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43149877-43262285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43212423 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 545 (T545A)

Ref Sequence

ENSEMBL: ENSMUSP00000076844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077659]

AlphaFold

B1AWN4

Predicted Effect

probably benign
Transcript: ENSMUST00000077659
AA Change: T545A

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: T545A

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	47	118	3.8e-26	PFAM
Pfam:E1-E2_ATPase	123	393	2.9e-7	PFAM
low complexity region	621	638	N/A	INTRINSIC
Pfam:Cation_ATPase	692	799	7.1e-9	PFAM
Pfam:HAD	705	1062	6.7e-12	PFAM
Pfam:PhoLip_ATPase_C	1079	1324	1.9e-79	PFAM
low complexity region	1353	1366	N/A	INTRINSIC
low complexity region	1457	1471	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127604

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	T	A	5: 146,184,871	M73L	possibly damaging	Het
AA986860	A	T	1: 130,741,069	I58F	probably damaging	Het
Acsl3	A	T	1: 78,699,811	K507N	probably damaging	Het
Adcy3	T	C	12: 4,173,512	Y245H	probably damaging	Het
Adgra1	T	C	7: 139,875,631	S392P	probably damaging	Het
Ahnak	C	T	19: 9,011,557	P3402S	probably damaging	Het
Ambra1	T	A	2: 91,766,600	I12N	possibly damaging	Het
Atxn2	G	T	5: 121,784,006	A638S	probably benign	Het
Cd109	T	C	9: 78,667,293	S520P	probably damaging	Het
Col6a3	T	C	1: 90,782,011	D1821G	unknown	Het
Cyp4a10	T	C	4: 115,525,308	V265A	possibly damaging	Het
Dmrtb1	C	T	4: 107,683,612	R184Q	possibly damaging	Het
Dnah7b	A	T	1: 46,241,067	I2719F	possibly damaging	Het
En2	T	C	5: 28,167,073	S183P	probably damaging	Het
Etfb	A	G	7: 43,456,500	T101A	probably benign	Het
Etl4	T	A	2: 20,743,549	S364T	probably damaging	Het
Fam196b	A	G	11: 34,402,141	D61G	probably benign	Het
Gm17728	C	A	17: 9,422,289	S77Y	possibly damaging	Het
Golga4	A	G	9: 118,532,590	E221G	probably damaging	Het
Gpr37	T	C	6: 25,688,417	N227S	possibly damaging	Het
Kctd1	A	T	18: 14,974,055	N784K	possibly damaging	Het
Klhl22	A	G	16: 17,776,525	T173A	probably benign	Het
Ly6e	T	A	15: 74,958,319	C41S	probably damaging	Het
Mapkbp1	T	C	2: 120,015,482	L444P	possibly damaging	Het
Mkx	A	T	18: 6,992,855	I143K	probably damaging	Het
Mlh3	A	G	12: 85,269,041	F124L	probably benign	Het
Nlrp1a	A	T	11: 71,124,220	L68H	possibly damaging	Het
Obscn	A	C	11: 59,073,631	Y726*	probably null	Het
Olfr1312	C	T	2: 112,042,553	V160I	probably benign	Het
Olfr26	T	G	9: 38,855,341	V93G	probably benign	Het
Peak1	G	A	9: 56,258,949	S565L	probably damaging	Het
Pter	T	A	2: 12,978,436	L84Q	probably damaging	Het
Ptpn4	A	G	1: 119,687,759	L555P	possibly damaging	Het
Rpp40	A	T	13: 35,898,992	M171K	probably benign	Het
Sacs	A	G	14: 61,206,506	I2000M	possibly damaging	Het
Scn5a	T	C	9: 119,492,123	I1458V	probably benign	Het
Slc38a4	T	C	15: 97,008,993	D288G	probably benign	Het
Slc8a2	T	G	7: 16,134,515	V224G	probably damaging	Het
Sptbn4	T	C	7: 27,428,256	E173G	probably benign	Het
Tas1r1	T	A	4: 152,028,391	H735L	probably benign	Het
Trps1	G	T	15: 50,822,305	Q155K	probably damaging	Het
Tspyl5	T	C	15: 33,686,746	H351R	probably damaging	Het
Ttf2	A	T	3: 100,969,501	D21E	probably benign	Het
Ttll7	A	G	3: 146,930,104	R398G	possibly damaging	Het
Tubgcp6	A	T	15: 89,122,376	Y148N	probably damaging	Het
Vmn1r8	T	A	6: 57,036,340	H125Q	probably benign	Het
Zfhx4	A	G	3: 5,403,163	T2794A	possibly damaging	Het
Zfp27	T	C	7: 29,894,783	I586V	probably benign	Het
Zfyve16	T	C	13: 92,524,262	D13G	probably damaging	Het

Other mutations in Atp10b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Atp10b	APN	11	43202161	missense	probably damaging	1.00
IGL01385:Atp10b	APN	11	43234429	missense	probably damaging	1.00
IGL01524:Atp10b	APN	11	43259845	missense	probably benign	0.18
IGL01575:Atp10b	APN	11	43172721	missense	probably benign	0.00
IGL01588:Atp10b	APN	11	43172721	missense	probably benign	0.00
IGL01590:Atp10b	APN	11	43172721	missense	probably benign	0.00
IGL01832:Atp10b	APN	11	43234435	missense	probably damaging	0.98
IGL01927:Atp10b	APN	11	43259404	splice site	probably benign
IGL01933:Atp10b	APN	11	43194630	missense	probably damaging	1.00
IGL02182:Atp10b	APN	11	43248947	missense	probably damaging	1.00
IGL02215:Atp10b	APN	11	43194665	critical splice donor site	probably null
IGL02216:Atp10b	APN	11	43259789	missense	probably damaging	0.98
IGL02973:Atp10b	APN	11	43197509	missense	probably damaging	1.00
IGL03012:Atp10b	APN	11	43194655	missense	probably damaging	0.99
IGL03106:Atp10b	APN	11	43247477	missense	probably benign	0.32
IGL03123:Atp10b	APN	11	43153283	missense	probably benign	0.01
IGL03202:Atp10b	APN	11	43234441	critical splice donor site	probably null
IGL03339:Atp10b	APN	11	43230615	missense	probably null	0.71
R0053:Atp10b	UTSW	11	43216564	splice site	probably benign
R0053:Atp10b	UTSW	11	43216564	splice site	probably benign
R0098:Atp10b	UTSW	11	43189604	missense	probably benign	0.00
R0098:Atp10b	UTSW	11	43189604	missense	probably benign	0.00
R0281:Atp10b	UTSW	11	43153304	missense	probably benign	0.00
R0379:Atp10b	UTSW	11	43254314	missense	probably benign	0.05
R0380:Atp10b	UTSW	11	43225597	missense	probably damaging	1.00
R0470:Atp10b	UTSW	11	43203039	missense	possibly damaging	0.88
R1355:Atp10b	UTSW	11	43151655	nonsense	probably null
R1368:Atp10b	UTSW	11	43202154	missense	probably damaging	1.00
R1370:Atp10b	UTSW	11	43151655	nonsense	probably null
R1413:Atp10b	UTSW	11	43230564	missense	probably benign	0.00
R1502:Atp10b	UTSW	11	43230347	missense	probably damaging	1.00
R1530:Atp10b	UTSW	11	43197524	missense	probably benign	0.03
R1596:Atp10b	UTSW	11	43235767	missense	probably damaging	1.00
R1675:Atp10b	UTSW	11	43225648	missense	probably damaging	1.00
R1880:Atp10b	UTSW	11	43259432	missense	probably damaging	1.00
R1938:Atp10b	UTSW	11	43230418	missense	probably benign	0.00
R1986:Atp10b	UTSW	11	43172768	missense	probably benign	0.12
R2081:Atp10b	UTSW	11	43202128	missense	probably damaging	1.00
R2159:Atp10b	UTSW	11	43151853	missense	possibly damaging	0.81
R2255:Atp10b	UTSW	11	43234380	missense	probably damaging	1.00
R2259:Atp10b	UTSW	11	43172745	missense	probably damaging	1.00
R2259:Atp10b	UTSW	11	43189613	missense	probably damaging	1.00
R3741:Atp10b	UTSW	11	43235662	missense	probably damaging	1.00
R3942:Atp10b	UTSW	11	43172754	missense	probably damaging	1.00
R3971:Atp10b	UTSW	11	43216512	missense	probably damaging	1.00
R4007:Atp10b	UTSW	11	43259852	missense	probably benign	0.04
R4050:Atp10b	UTSW	11	43259536	missense	probably benign	0.00
R4078:Atp10b	UTSW	11	43153283	missense	probably benign	0.01
R4567:Atp10b	UTSW	11	43197557	missense	probably benign	0.03
R4651:Atp10b	UTSW	11	43194645	missense	probably damaging	1.00
R4652:Atp10b	UTSW	11	43194645	missense	probably damaging	1.00
R4667:Atp10b	UTSW	11	43247518	missense	probably damaging	1.00
R4720:Atp10b	UTSW	11	43203122	missense	probably benign
R4987:Atp10b	UTSW	11	43151613	utr 5 prime	probably benign
R5232:Atp10b	UTSW	11	43202179	missense	probably damaging	1.00
R5233:Atp10b	UTSW	11	43230560	missense	probably benign	0.06
R5281:Atp10b	UTSW	11	43254336	missense	probably damaging	0.97
R5307:Atp10b	UTSW	11	43212475	missense	probably damaging	1.00
R5460:Atp10b	UTSW	11	43230455	missense	probably benign	0.00
R5518:Atp10b	UTSW	11	43151636	missense	possibly damaging	0.84
R5659:Atp10b	UTSW	11	43245425	missense	probably damaging	1.00
R5688:Atp10b	UTSW	11	43201173	missense	probably benign	0.00
R5735:Atp10b	UTSW	11	43151774	missense	probably benign	0.00
R6153:Atp10b	UTSW	11	43254282	missense	probably damaging	1.00
R6251:Atp10b	UTSW	11	43235746	missense	possibly damaging	0.95
R6259:Atp10b	UTSW	11	43201238	missense	probably benign	0.24
R6394:Atp10b	UTSW	11	43225637	missense	probably damaging	1.00
R6492:Atp10b	UTSW	11	43218957	missense	probably damaging	1.00
R6769:Atp10b	UTSW	11	43203252	critical splice donor site	probably null
R6771:Atp10b	UTSW	11	43203252	critical splice donor site	probably null
R6775:Atp10b	UTSW	11	43222213	missense	possibly damaging	0.80
R7134:Atp10b	UTSW	11	43245464	missense	probably damaging	1.00
R7322:Atp10b	UTSW	11	43212547	missense	probably damaging	1.00
R7367:Atp10b	UTSW	11	43247501	missense	probably damaging	1.00
R7538:Atp10b	UTSW	11	43225546	missense	probably benign	0.04
R7708:Atp10b	UTSW	11	43202143	missense	probably damaging	1.00
R7787:Atp10b	UTSW	11	43259873	missense	possibly damaging	0.91
R8145:Atp10b	UTSW	11	43202122	missense	probably damaging	1.00
R8406:Atp10b	UTSW	11	43203157	missense	probably benign	0.00
R8503:Atp10b	UTSW	11	43222239	missense	possibly damaging	0.92
R8542:Atp10b	UTSW	11	43230381	missense	probably benign	0.18
R8744:Atp10b	UTSW	11	43230350	missense	probably damaging	1.00
R8815:Atp10b	UTSW	11	43203151	missense	possibly damaging	0.63
R8833:Atp10b	UTSW	11	43222159	missense	probably damaging	1.00
R8880:Atp10b	UTSW	11	43215984	missense	probably benign
R8989:Atp10b	UTSW	11	43245442	nonsense	probably null
R8998:Atp10b	UTSW	11	43259899	makesense	probably null
R9255:Atp10b	UTSW	11	43216321	missense	probably damaging	1.00
R9281:Atp10b	UTSW	11	43225631	missense	probably benign	0.11
R9345:Atp10b	UTSW	11	43203197	missense	probably damaging	0.99
R9357:Atp10b	UTSW	11	43259884	missense	probably benign	0.18
R9393:Atp10b	UTSW	11	43172781	missense	probably damaging	1.00
R9516:Atp10b	UTSW	11	43230397	missense	probably benign	0.02
R9644:Atp10b	UTSW	11	43151832	missense	probably damaging	1.00
R9747:Atp10b	UTSW	11	43197512	missense	probably benign
Z1177:Atp10b	UTSW	11	43153349	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TCCAGTTGCAGGGAGGAATG -3'
(R):5'- GCCTTTCTGATCAGGGATTTCC -3'

Sequencing Primer
(F):5'- TGCAGGGAGGAATGTGCTG -3'
(R):5'- AATCATCACTCCACCTTACCCTC -3'

Posted On

2014-09-18