Mutagenetix > Incidental Mutation

Incidental Mutation 'R2083:Mlh3'

230161

Institutional Source

Beutler Lab

Gene Symbol

Mlh3

Ensembl Gene

ENSMUSG00000021245

Gene Name

mutL homolog 3

Synonyms

MMRRC Submission

040088-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85234520-85270599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85269041 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 124 (F124L)

Ref Sequence

ENSEMBL: ENSMUSP00000152840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000019378] [ENSMUST00000117138] [ENSMUST00000121930] [ENSMUST00000166821] [ENSMUST00000220854] [ENSMUST00000223230]

AlphaFold

A0A1Y7VMP7

Predicted Effect

probably benign
Transcript: ENSMUST00000008966

SMART Domains

Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822

Domain	Start	End	E-Value	Type
Pfam:Acylphosphatase	1	98	6e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000019378
AA Change: F124L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000019378
Gene: ENSMUSG00000021245
AA Change: F124L

Domain	Start	End	E-Value	Type
HATPase_c	17	125	1.04e0	SMART
DNA_mis_repair	211	349	8.78e-22	SMART
low complexity region	582	594	N/A	INTRINSIC
low complexity region	658	671	N/A	INTRINSIC
low complexity region	863	882	N/A	INTRINSIC
low complexity region	1078	1096	N/A	INTRINSIC
MutL_C	1153	1334	7.45e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117138

SMART Domains

Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822

Domain	Start	End	E-Value	Type
Pfam:Acylphosphatase	1	98	6e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121930

SMART Domains

Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822

Domain	Start	End	E-Value	Type
Pfam:Acylphosphatase	64	156	4.5e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166821
AA Change: F124L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000129900
Gene: ENSMUSG00000021245
AA Change: F124L

Domain	Start	End	E-Value	Type
HATPase_c	17	125	1.04e0	SMART
DNA_mis_repair	211	349	8.78e-22	SMART
low complexity region	582	594	N/A	INTRINSIC
low complexity region	658	671	N/A	INTRINSIC
low complexity region	863	882	N/A	INTRINSIC
low complexity region	1078	1096	N/A	INTRINSIC
MutL_C	1153	1334	7.45e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220854
AA Change: F124L

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000223230

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Both oocytes and spermatocytes exhibit meiotic block and die. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	T	A	5: 146,184,871	M73L	possibly damaging	Het
AA986860	A	T	1: 130,741,069	I58F	probably damaging	Het
Acsl3	A	T	1: 78,699,811	K507N	probably damaging	Het
Adcy3	T	C	12: 4,173,512	Y245H	probably damaging	Het
Adgra1	T	C	7: 139,875,631	S392P	probably damaging	Het
Ahnak	C	T	19: 9,011,557	P3402S	probably damaging	Het
Ambra1	T	A	2: 91,766,600	I12N	possibly damaging	Het
Atp10b	A	G	11: 43,212,423	T545A	probably benign	Het
Atxn2	G	T	5: 121,784,006	A638S	probably benign	Het
Cd109	T	C	9: 78,667,293	S520P	probably damaging	Het
Col6a3	T	C	1: 90,782,011	D1821G	unknown	Het
Cyp4a10	T	C	4: 115,525,308	V265A	possibly damaging	Het
Dmrtb1	C	T	4: 107,683,612	R184Q	possibly damaging	Het
Dnah7b	A	T	1: 46,241,067	I2719F	possibly damaging	Het
En2	T	C	5: 28,167,073	S183P	probably damaging	Het
Etfb	A	G	7: 43,456,500	T101A	probably benign	Het
Etl4	T	A	2: 20,743,549	S364T	probably damaging	Het
Fam196b	A	G	11: 34,402,141	D61G	probably benign	Het
Gm17728	C	A	17: 9,422,289	S77Y	possibly damaging	Het
Golga4	A	G	9: 118,532,590	E221G	probably damaging	Het
Gpr37	T	C	6: 25,688,417	N227S	possibly damaging	Het
Kctd1	A	T	18: 14,974,055	N784K	possibly damaging	Het
Klhl22	A	G	16: 17,776,525	T173A	probably benign	Het
Ly6e	T	A	15: 74,958,319	C41S	probably damaging	Het
Mapkbp1	T	C	2: 120,015,482	L444P	possibly damaging	Het
Mkx	A	T	18: 6,992,855	I143K	probably damaging	Het
Nlrp1a	A	T	11: 71,124,220	L68H	possibly damaging	Het
Obscn	A	C	11: 59,073,631	Y726*	probably null	Het
Olfr1312	C	T	2: 112,042,553	V160I	probably benign	Het
Olfr26	T	G	9: 38,855,341	V93G	probably benign	Het
Peak1	G	A	9: 56,258,949	S565L	probably damaging	Het
Pter	T	A	2: 12,978,436	L84Q	probably damaging	Het
Ptpn4	A	G	1: 119,687,759	L555P	possibly damaging	Het
Rpp40	A	T	13: 35,898,992	M171K	probably benign	Het
Sacs	A	G	14: 61,206,506	I2000M	possibly damaging	Het
Scn5a	T	C	9: 119,492,123	I1458V	probably benign	Het
Slc38a4	T	C	15: 97,008,993	D288G	probably benign	Het
Slc8a2	T	G	7: 16,134,515	V224G	probably damaging	Het
Sptbn4	T	C	7: 27,428,256	E173G	probably benign	Het
Tas1r1	T	A	4: 152,028,391	H735L	probably benign	Het
Trps1	G	T	15: 50,822,305	Q155K	probably damaging	Het
Tspyl5	T	C	15: 33,686,746	H351R	probably damaging	Het
Ttf2	A	T	3: 100,969,501	D21E	probably benign	Het
Ttll7	A	G	3: 146,930,104	R398G	possibly damaging	Het
Tubgcp6	A	T	15: 89,122,376	Y148N	probably damaging	Het
Vmn1r8	T	A	6: 57,036,340	H125Q	probably benign	Het
Zfhx4	A	G	3: 5,403,163	T2794A	possibly damaging	Het
Zfp27	T	C	7: 29,894,783	I586V	probably benign	Het
Zfyve16	T	C	13: 92,524,262	D13G	probably damaging	Het

Other mutations in Mlh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Mlh3	APN	12	85267929	missense	probably benign
IGL01462:Mlh3	APN	12	85266736	missense	probably benign
IGL01961:Mlh3	APN	12	85266344	missense	probably benign	0.00
IGL02596:Mlh3	APN	12	85240958	critical splice donor site	probably null
IGL03008:Mlh3	APN	12	85240851	missense	probably benign	0.23
IGL03142:Mlh3	APN	12	85250301	critical splice donor site	probably null
R0032:Mlh3	UTSW	12	85245749	intron	probably benign
R0032:Mlh3	UTSW	12	85245749	intron	probably benign
R0078:Mlh3	UTSW	12	85268818	missense	probably damaging	0.98
R0129:Mlh3	UTSW	12	85266140	splice site	probably benign
R0269:Mlh3	UTSW	12	85268405	missense	probably benign	0.00
R0393:Mlh3	UTSW	12	85267587	nonsense	probably null
R0403:Mlh3	UTSW	12	85268968	missense	possibly damaging	0.93
R0409:Mlh3	UTSW	12	85240854	missense	possibly damaging	0.95
R0587:Mlh3	UTSW	12	85266419	missense	probably benign	0.00
R0701:Mlh3	UTSW	12	85267903	missense	probably benign	0.00
R0718:Mlh3	UTSW	12	85247697	missense	possibly damaging	0.86
R0883:Mlh3	UTSW	12	85235714	missense	possibly damaging	0.89
R0989:Mlh3	UTSW	12	85269395	missense	probably benign	0.22
R0990:Mlh3	UTSW	12	85267765	missense	probably benign
R1467:Mlh3	UTSW	12	85237600	nonsense	probably null
R1467:Mlh3	UTSW	12	85237600	nonsense	probably null
R1562:Mlh3	UTSW	12	85266920	missense	probably benign	0.14
R1599:Mlh3	UTSW	12	85268369	missense	probably damaging	1.00
R1694:Mlh3	UTSW	12	85267141	missense	probably damaging	1.00
R1777:Mlh3	UTSW	12	85268754	missense	possibly damaging	0.75
R1822:Mlh3	UTSW	12	85266145	splice site	probably benign
R1874:Mlh3	UTSW	12	85237513	critical splice donor site	probably null
R1914:Mlh3	UTSW	12	85261668	missense	probably benign	0.08
R1915:Mlh3	UTSW	12	85261668	missense	probably benign	0.08
R2075:Mlh3	UTSW	12	85269141	nonsense	probably null
R2267:Mlh3	UTSW	12	85260811	missense	possibly damaging	0.55
R2334:Mlh3	UTSW	12	85268077	missense	probably benign	0.00
R2882:Mlh3	UTSW	12	85267566	missense	probably damaging	1.00
R3623:Mlh3	UTSW	12	85268395	missense	probably damaging	1.00
R3624:Mlh3	UTSW	12	85268395	missense	probably damaging	1.00
R3963:Mlh3	UTSW	12	85268680	missense	possibly damaging	0.94
R4376:Mlh3	UTSW	12	85259198	missense	probably benign	0.00
R5334:Mlh3	UTSW	12	85245761	critical splice donor site	probably null
R5526:Mlh3	UTSW	12	85269373	nonsense	probably null
R5556:Mlh3	UTSW	12	85268493	nonsense	probably null
R5611:Mlh3	UTSW	12	85267445	missense	probably benign	0.21
R5911:Mlh3	UTSW	12	85268455	missense	probably damaging	1.00
R6050:Mlh3	UTSW	12	85240846	missense	possibly damaging	0.89
R6221:Mlh3	UTSW	12	85268418	missense	possibly damaging	0.94
R6377:Mlh3	UTSW	12	85268497	missense	probably damaging	0.97
R6820:Mlh3	UTSW	12	85247723	missense	probably damaging	1.00
R6826:Mlh3	UTSW	12	85245824	missense	probably benign	0.38
R6992:Mlh3	UTSW	12	85235720	missense	probably damaging	1.00
R7217:Mlh3	UTSW	12	85266707	missense	probably benign
R7228:Mlh3	UTSW	12	85235656	missense	probably benign	0.07
R7348:Mlh3	UTSW	12	85267441	missense	probably damaging	0.99
R7599:Mlh3	UTSW	12	85268199	nonsense	probably null
R7722:Mlh3	UTSW	12	85267492	missense	probably benign	0.01
R7762:Mlh3	UTSW	12	85268284	missense	possibly damaging	0.63
R7786:Mlh3	UTSW	12	85266737	missense	probably benign	0.00
R8231:Mlh3	UTSW	12	85260798	critical splice donor site	probably null
R8415:Mlh3	UTSW	12	85269080	missense	probably benign	0.35
R8750:Mlh3	UTSW	12	85261714	missense	probably damaging	0.99
R8794:Mlh3	UTSW	12	85235723	missense	probably damaging	1.00
R9301:Mlh3	UTSW	12	85245839	missense	possibly damaging	0.77
R9385:Mlh3	UTSW	12	85269370	missense	probably damaging	1.00
R9518:Mlh3	UTSW	12	85266230	missense	probably benign	0.00
R9549:Mlh3	UTSW	12	85266475	missense	probably benign	0.01
RF014:Mlh3	UTSW	12	85268029	missense	probably benign
X0024:Mlh3	UTSW	12	85247669	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGATACATCGTTCCTCAAAG -3'
(R):5'- ACAATGGACTTGGGATGGCG -3'

Sequencing Primer
(F):5'- GATACATCGTTCCTCAAAGAGAAAG -3'
(R):5'- CTTGGGATGGCGGGGGAC -3'

Posted On

2014-09-18