Incidental Mutation 'R2083:Mlh3'
ID 230161
Institutional Source Beutler Lab
Gene Symbol Mlh3
Ensembl Gene ENSMUSG00000021245
Gene Name mutL homolog 3
Synonyms
MMRRC Submission 040088-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 85234520-85270599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85269041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 124 (F124L)
Ref Sequence ENSEMBL: ENSMUSP00000152840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000019378] [ENSMUST00000117138] [ENSMUST00000121930] [ENSMUST00000166821] [ENSMUST00000220854] [ENSMUST00000223230]
AlphaFold A0A1Y7VMP7
Predicted Effect probably benign
Transcript: ENSMUST00000008966
SMART Domains Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019378
AA Change: F124L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000019378
Gene: ENSMUSG00000021245
AA Change: F124L

DomainStartEndE-ValueType
HATPase_c 17 125 1.04e0 SMART
DNA_mis_repair 211 349 8.78e-22 SMART
low complexity region 582 594 N/A INTRINSIC
low complexity region 658 671 N/A INTRINSIC
low complexity region 863 882 N/A INTRINSIC
low complexity region 1078 1096 N/A INTRINSIC
MutL_C 1153 1334 7.45e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117138
SMART Domains Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121930
SMART Domains Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 64 156 4.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166821
AA Change: F124L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129900
Gene: ENSMUSG00000021245
AA Change: F124L

DomainStartEndE-ValueType
HATPase_c 17 125 1.04e0 SMART
DNA_mis_repair 211 349 8.78e-22 SMART
low complexity region 582 594 N/A INTRINSIC
low complexity region 658 671 N/A INTRINSIC
low complexity region 863 882 N/A INTRINSIC
low complexity region 1078 1096 N/A INTRINSIC
MutL_C 1153 1334 7.45e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220854
AA Change: F124L

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000223230
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Both oocytes and spermatocytes exhibit meiotic block and die. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,184,871 M73L possibly damaging Het
AA986860 A T 1: 130,741,069 I58F probably damaging Het
Acsl3 A T 1: 78,699,811 K507N probably damaging Het
Adcy3 T C 12: 4,173,512 Y245H probably damaging Het
Adgra1 T C 7: 139,875,631 S392P probably damaging Het
Ahnak C T 19: 9,011,557 P3402S probably damaging Het
Ambra1 T A 2: 91,766,600 I12N possibly damaging Het
Atp10b A G 11: 43,212,423 T545A probably benign Het
Atxn2 G T 5: 121,784,006 A638S probably benign Het
Cd109 T C 9: 78,667,293 S520P probably damaging Het
Col6a3 T C 1: 90,782,011 D1821G unknown Het
Cyp4a10 T C 4: 115,525,308 V265A possibly damaging Het
Dmrtb1 C T 4: 107,683,612 R184Q possibly damaging Het
Dnah7b A T 1: 46,241,067 I2719F possibly damaging Het
En2 T C 5: 28,167,073 S183P probably damaging Het
Etfb A G 7: 43,456,500 T101A probably benign Het
Etl4 T A 2: 20,743,549 S364T probably damaging Het
Fam196b A G 11: 34,402,141 D61G probably benign Het
Gm17728 C A 17: 9,422,289 S77Y possibly damaging Het
Golga4 A G 9: 118,532,590 E221G probably damaging Het
Gpr37 T C 6: 25,688,417 N227S possibly damaging Het
Kctd1 A T 18: 14,974,055 N784K possibly damaging Het
Klhl22 A G 16: 17,776,525 T173A probably benign Het
Ly6e T A 15: 74,958,319 C41S probably damaging Het
Mapkbp1 T C 2: 120,015,482 L444P possibly damaging Het
Mkx A T 18: 6,992,855 I143K probably damaging Het
Nlrp1a A T 11: 71,124,220 L68H possibly damaging Het
Obscn A C 11: 59,073,631 Y726* probably null Het
Olfr1312 C T 2: 112,042,553 V160I probably benign Het
Olfr26 T G 9: 38,855,341 V93G probably benign Het
Peak1 G A 9: 56,258,949 S565L probably damaging Het
Pter T A 2: 12,978,436 L84Q probably damaging Het
Ptpn4 A G 1: 119,687,759 L555P possibly damaging Het
Rpp40 A T 13: 35,898,992 M171K probably benign Het
Sacs A G 14: 61,206,506 I2000M possibly damaging Het
Scn5a T C 9: 119,492,123 I1458V probably benign Het
Slc38a4 T C 15: 97,008,993 D288G probably benign Het
Slc8a2 T G 7: 16,134,515 V224G probably damaging Het
Sptbn4 T C 7: 27,428,256 E173G probably benign Het
Tas1r1 T A 4: 152,028,391 H735L probably benign Het
Trps1 G T 15: 50,822,305 Q155K probably damaging Het
Tspyl5 T C 15: 33,686,746 H351R probably damaging Het
Ttf2 A T 3: 100,969,501 D21E probably benign Het
Ttll7 A G 3: 146,930,104 R398G possibly damaging Het
Tubgcp6 A T 15: 89,122,376 Y148N probably damaging Het
Vmn1r8 T A 6: 57,036,340 H125Q probably benign Het
Zfhx4 A G 3: 5,403,163 T2794A possibly damaging Het
Zfp27 T C 7: 29,894,783 I586V probably benign Het
Zfyve16 T C 13: 92,524,262 D13G probably damaging Het
Other mutations in Mlh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Mlh3 APN 12 85267929 missense probably benign
IGL01462:Mlh3 APN 12 85266736 missense probably benign
IGL01961:Mlh3 APN 12 85266344 missense probably benign 0.00
IGL02596:Mlh3 APN 12 85240958 critical splice donor site probably null
IGL03008:Mlh3 APN 12 85240851 missense probably benign 0.23
IGL03142:Mlh3 APN 12 85250301 critical splice donor site probably null
R0032:Mlh3 UTSW 12 85245749 intron probably benign
R0032:Mlh3 UTSW 12 85245749 intron probably benign
R0078:Mlh3 UTSW 12 85268818 missense probably damaging 0.98
R0129:Mlh3 UTSW 12 85266140 splice site probably benign
R0269:Mlh3 UTSW 12 85268405 missense probably benign 0.00
R0393:Mlh3 UTSW 12 85267587 nonsense probably null
R0403:Mlh3 UTSW 12 85268968 missense possibly damaging 0.93
R0409:Mlh3 UTSW 12 85240854 missense possibly damaging 0.95
R0587:Mlh3 UTSW 12 85266419 missense probably benign 0.00
R0701:Mlh3 UTSW 12 85267903 missense probably benign 0.00
R0718:Mlh3 UTSW 12 85247697 missense possibly damaging 0.86
R0883:Mlh3 UTSW 12 85235714 missense possibly damaging 0.89
R0989:Mlh3 UTSW 12 85269395 missense probably benign 0.22
R0990:Mlh3 UTSW 12 85267765 missense probably benign
R1467:Mlh3 UTSW 12 85237600 nonsense probably null
R1467:Mlh3 UTSW 12 85237600 nonsense probably null
R1562:Mlh3 UTSW 12 85266920 missense probably benign 0.14
R1599:Mlh3 UTSW 12 85268369 missense probably damaging 1.00
R1694:Mlh3 UTSW 12 85267141 missense probably damaging 1.00
R1777:Mlh3 UTSW 12 85268754 missense possibly damaging 0.75
R1822:Mlh3 UTSW 12 85266145 splice site probably benign
R1874:Mlh3 UTSW 12 85237513 critical splice donor site probably null
R1914:Mlh3 UTSW 12 85261668 missense probably benign 0.08
R1915:Mlh3 UTSW 12 85261668 missense probably benign 0.08
R2075:Mlh3 UTSW 12 85269141 nonsense probably null
R2267:Mlh3 UTSW 12 85260811 missense possibly damaging 0.55
R2334:Mlh3 UTSW 12 85268077 missense probably benign 0.00
R2882:Mlh3 UTSW 12 85267566 missense probably damaging 1.00
R3623:Mlh3 UTSW 12 85268395 missense probably damaging 1.00
R3624:Mlh3 UTSW 12 85268395 missense probably damaging 1.00
R3963:Mlh3 UTSW 12 85268680 missense possibly damaging 0.94
R4376:Mlh3 UTSW 12 85259198 missense probably benign 0.00
R5334:Mlh3 UTSW 12 85245761 critical splice donor site probably null
R5526:Mlh3 UTSW 12 85269373 nonsense probably null
R5556:Mlh3 UTSW 12 85268493 nonsense probably null
R5611:Mlh3 UTSW 12 85267445 missense probably benign 0.21
R5911:Mlh3 UTSW 12 85268455 missense probably damaging 1.00
R6050:Mlh3 UTSW 12 85240846 missense possibly damaging 0.89
R6221:Mlh3 UTSW 12 85268418 missense possibly damaging 0.94
R6377:Mlh3 UTSW 12 85268497 missense probably damaging 0.97
R6820:Mlh3 UTSW 12 85247723 missense probably damaging 1.00
R6826:Mlh3 UTSW 12 85245824 missense probably benign 0.38
R6992:Mlh3 UTSW 12 85235720 missense probably damaging 1.00
R7217:Mlh3 UTSW 12 85266707 missense probably benign
R7228:Mlh3 UTSW 12 85235656 missense probably benign 0.07
R7348:Mlh3 UTSW 12 85267441 missense probably damaging 0.99
R7599:Mlh3 UTSW 12 85268199 nonsense probably null
R7722:Mlh3 UTSW 12 85267492 missense probably benign 0.01
R7762:Mlh3 UTSW 12 85268284 missense possibly damaging 0.63
R7786:Mlh3 UTSW 12 85266737 missense probably benign 0.00
R8231:Mlh3 UTSW 12 85260798 critical splice donor site probably null
R8415:Mlh3 UTSW 12 85269080 missense probably benign 0.35
R8750:Mlh3 UTSW 12 85261714 missense probably damaging 0.99
R8794:Mlh3 UTSW 12 85235723 missense probably damaging 1.00
R9301:Mlh3 UTSW 12 85245839 missense possibly damaging 0.77
R9385:Mlh3 UTSW 12 85269370 missense probably damaging 1.00
R9518:Mlh3 UTSW 12 85266230 missense probably benign 0.00
R9549:Mlh3 UTSW 12 85266475 missense probably benign 0.01
RF014:Mlh3 UTSW 12 85268029 missense probably benign
X0024:Mlh3 UTSW 12 85247669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGATACATCGTTCCTCAAAG -3'
(R):5'- ACAATGGACTTGGGATGGCG -3'

Sequencing Primer
(F):5'- GATACATCGTTCCTCAAAGAGAAAG -3'
(R):5'- CTTGGGATGGCGGGGGAC -3'
Posted On 2014-09-18