Incidental Mutation 'R2083:Sacs'
ID 230165
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Name sacsin
Synonyms E130115J16Rik
MMRRC Submission 040088-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 61375906-61478144 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61443955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 2000 (I2000M)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943] [ENSMUST00000229692]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119943
AA Change: I2000M

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: I2000M

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150222
Predicted Effect probably benign
Transcript: ENSMUST00000229692
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,121,681 (GRCm39) M73L possibly damaging Het
AA986860 A T 1: 130,668,806 (GRCm39) I58F probably damaging Het
Acsl3 A T 1: 78,677,528 (GRCm39) K507N probably damaging Het
Adcy3 T C 12: 4,223,512 (GRCm39) Y245H probably damaging Het
Adgra1 T C 7: 139,455,547 (GRCm39) S392P probably damaging Het
Ahnak C T 19: 8,988,921 (GRCm39) P3402S probably damaging Het
Ambra1 T A 2: 91,596,945 (GRCm39) I12N possibly damaging Het
Atp10b A G 11: 43,103,250 (GRCm39) T545A probably benign Het
Atxn2 G T 5: 121,922,069 (GRCm39) A638S probably benign Het
Cd109 T C 9: 78,574,575 (GRCm39) S520P probably damaging Het
Col6a3 T C 1: 90,709,733 (GRCm39) D1821G unknown Het
Cyp4a10 T C 4: 115,382,505 (GRCm39) V265A possibly damaging Het
Dmrtb1 C T 4: 107,540,809 (GRCm39) R184Q possibly damaging Het
Dnah7b A T 1: 46,280,227 (GRCm39) I2719F possibly damaging Het
En2 T C 5: 28,372,071 (GRCm39) S183P probably damaging Het
Etfb A G 7: 43,105,924 (GRCm39) T101A probably benign Het
Etl4 T A 2: 20,748,360 (GRCm39) S364T probably damaging Het
Gm17728 C A 17: 9,641,121 (GRCm39) S77Y possibly damaging Het
Golga4 A G 9: 118,361,658 (GRCm39) E221G probably damaging Het
Gpr37 T C 6: 25,688,416 (GRCm39) N227S possibly damaging Het
Insyn2b A G 11: 34,352,141 (GRCm39) D61G probably benign Het
Kctd1 A T 18: 15,107,112 (GRCm39) N784K possibly damaging Het
Klhl22 A G 16: 17,594,389 (GRCm39) T173A probably benign Het
Ly6e T A 15: 74,830,168 (GRCm39) C41S probably damaging Het
Mapkbp1 T C 2: 119,845,963 (GRCm39) L444P possibly damaging Het
Mkx A T 18: 6,992,855 (GRCm39) I143K probably damaging Het
Mlh3 A G 12: 85,315,815 (GRCm39) F124L probably benign Het
Nlrp1a A T 11: 71,015,046 (GRCm39) L68H possibly damaging Het
Obscn A C 11: 58,964,457 (GRCm39) Y726* probably null Het
Or4f59 C T 2: 111,872,898 (GRCm39) V160I probably benign Het
Or8d1 T G 9: 38,766,637 (GRCm39) V93G probably benign Het
Peak1 G A 9: 56,166,233 (GRCm39) S565L probably damaging Het
Pter T A 2: 12,983,247 (GRCm39) L84Q probably damaging Het
Ptpn4 A G 1: 119,615,489 (GRCm39) L555P possibly damaging Het
Rpp40 A T 13: 36,082,975 (GRCm39) M171K probably benign Het
Scn5a T C 9: 119,321,189 (GRCm39) I1458V probably benign Het
Slc38a4 T C 15: 96,906,874 (GRCm39) D288G probably benign Het
Slc8a2 T G 7: 15,868,440 (GRCm39) V224G probably damaging Het
Sptbn4 T C 7: 27,127,681 (GRCm39) E173G probably benign Het
Tas1r1 T A 4: 152,112,848 (GRCm39) H735L probably benign Het
Trps1 G T 15: 50,685,701 (GRCm39) Q155K probably damaging Het
Tspyl5 T C 15: 33,686,892 (GRCm39) H351R probably damaging Het
Ttf2 A T 3: 100,876,817 (GRCm39) D21E probably benign Het
Ttll7 A G 3: 146,635,859 (GRCm39) R398G possibly damaging Het
Tubgcp6 A T 15: 89,006,579 (GRCm39) Y148N probably damaging Het
Vmn1r8 T A 6: 57,013,325 (GRCm39) H125Q probably benign Het
Zfhx4 A G 3: 5,468,223 (GRCm39) T2794A possibly damaging Het
Zfp27 T C 7: 29,594,208 (GRCm39) I586V probably benign Het
Zfyve16 T C 13: 92,660,770 (GRCm39) D13G probably damaging Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61,429,084 (GRCm39) missense possibly damaging 0.64
IGL01839:Sacs APN 14 61,421,394 (GRCm39) intron probably benign
IGL02024:Sacs APN 14 61,427,127 (GRCm39) missense probably damaging 0.96
IGL02247:Sacs APN 14 61,429,984 (GRCm39) missense probably damaging 1.00
BB009:Sacs UTSW 14 61,442,327 (GRCm39) missense probably damaging 0.99
BB019:Sacs UTSW 14 61,442,327 (GRCm39) missense probably damaging 0.99
F6893:Sacs UTSW 14 61,450,425 (GRCm39) missense probably benign
IGL03052:Sacs UTSW 14 61,445,307 (GRCm39) missense probably damaging 0.99
R0090:Sacs UTSW 14 61,442,889 (GRCm39) missense probably damaging 1.00
R0102:Sacs UTSW 14 61,442,017 (GRCm39) missense probably damaging 1.00
R0102:Sacs UTSW 14 61,442,017 (GRCm39) missense probably damaging 1.00
R0390:Sacs UTSW 14 61,443,089 (GRCm39) missense possibly damaging 0.92
R0479:Sacs UTSW 14 61,428,928 (GRCm39) missense probably damaging 0.99
R0556:Sacs UTSW 14 61,421,407 (GRCm39) missense probably damaging 0.99
R0673:Sacs UTSW 14 61,447,664 (GRCm39) missense possibly damaging 0.89
R0748:Sacs UTSW 14 61,446,714 (GRCm39) missense probably damaging 0.99
R0931:Sacs UTSW 14 61,440,944 (GRCm39) missense probably benign
R0972:Sacs UTSW 14 61,449,412 (GRCm39) nonsense probably null
R1281:Sacs UTSW 14 61,429,250 (GRCm39) missense probably benign 0.02
R1340:Sacs UTSW 14 61,441,958 (GRCm39) missense probably damaging 0.98
R1351:Sacs UTSW 14 61,440,210 (GRCm39) missense probably benign 0.00
R1499:Sacs UTSW 14 61,451,153 (GRCm39) missense possibly damaging 0.70
R1538:Sacs UTSW 14 61,447,508 (GRCm39) missense probably damaging 0.98
R1581:Sacs UTSW 14 61,451,128 (GRCm39) missense probably damaging 0.96
R1599:Sacs UTSW 14 61,441,087 (GRCm39) missense probably benign
R1631:Sacs UTSW 14 61,448,181 (GRCm39) nonsense probably null
R1635:Sacs UTSW 14 61,441,277 (GRCm39) missense probably damaging 0.98
R1655:Sacs UTSW 14 61,429,231 (GRCm39) missense probably benign
R1660:Sacs UTSW 14 61,446,458 (GRCm39) missense probably damaging 0.99
R1707:Sacs UTSW 14 61,447,211 (GRCm39) missense probably benign 0.01
R1733:Sacs UTSW 14 61,442,903 (GRCm39) missense probably damaging 1.00
R1772:Sacs UTSW 14 61,448,346 (GRCm39) missense probably damaging 1.00
R1976:Sacs UTSW 14 61,440,344 (GRCm39) missense probably benign
R2055:Sacs UTSW 14 61,451,498 (GRCm39) missense probably damaging 0.97
R2091:Sacs UTSW 14 61,429,368 (GRCm39) missense possibly damaging 0.95
R2105:Sacs UTSW 14 61,410,890 (GRCm39) missense possibly damaging 0.90
R2109:Sacs UTSW 14 61,410,902 (GRCm39) splice site probably null
R2117:Sacs UTSW 14 61,451,220 (GRCm39) missense probably benign 0.01
R2122:Sacs UTSW 14 61,449,765 (GRCm39) missense probably damaging 1.00
R2148:Sacs UTSW 14 61,410,827 (GRCm39) missense probably damaging 0.97
R2151:Sacs UTSW 14 61,447,089 (GRCm39) missense probably damaging 1.00
R2231:Sacs UTSW 14 61,443,378 (GRCm39) splice site probably null
R2248:Sacs UTSW 14 61,450,251 (GRCm39) missense probably damaging 1.00
R2271:Sacs UTSW 14 61,442,109 (GRCm39) missense probably benign 0.06
R2314:Sacs UTSW 14 61,445,208 (GRCm39) missense probably benign 0.17
R2436:Sacs UTSW 14 61,440,354 (GRCm39) missense possibly damaging 0.94
R2445:Sacs UTSW 14 61,442,655 (GRCm39) missense probably damaging 1.00
R2512:Sacs UTSW 14 61,440,529 (GRCm39) missense probably benign 0.00
R3434:Sacs UTSW 14 61,449,752 (GRCm39) missense probably damaging 1.00
R3785:Sacs UTSW 14 61,421,410 (GRCm39) missense probably damaging 1.00
R3786:Sacs UTSW 14 61,421,410 (GRCm39) missense probably damaging 1.00
R3796:Sacs UTSW 14 61,443,570 (GRCm39) missense possibly damaging 0.87
R3798:Sacs UTSW 14 61,443,570 (GRCm39) missense possibly damaging 0.87
R3872:Sacs UTSW 14 61,385,517 (GRCm39) missense probably benign 0.30
R3873:Sacs UTSW 14 61,429,735 (GRCm39) missense possibly damaging 0.64
R3892:Sacs UTSW 14 61,441,836 (GRCm39) missense probably damaging 0.98
R4184:Sacs UTSW 14 61,451,393 (GRCm39) missense probably damaging 0.97
R4204:Sacs UTSW 14 61,410,892 (GRCm39) missense possibly damaging 0.93
R4249:Sacs UTSW 14 61,440,906 (GRCm39) missense probably benign 0.02
R4256:Sacs UTSW 14 61,443,786 (GRCm39) missense probably damaging 1.00
R4370:Sacs UTSW 14 61,449,758 (GRCm39) missense probably damaging 1.00
R4445:Sacs UTSW 14 61,442,135 (GRCm39) missense probably benign 0.30
R4503:Sacs UTSW 14 61,445,052 (GRCm39) missense probably damaging 1.00
R4548:Sacs UTSW 14 61,429,387 (GRCm39) missense probably damaging 1.00
R4582:Sacs UTSW 14 61,429,147 (GRCm39) missense probably damaging 1.00
R4613:Sacs UTSW 14 61,449,246 (GRCm39) splice site probably null
R4639:Sacs UTSW 14 61,444,717 (GRCm39) missense probably benign 0.12
R4697:Sacs UTSW 14 61,450,196 (GRCm39) missense probably benign 0.19
R4706:Sacs UTSW 14 61,441,722 (GRCm39) missense probably damaging 1.00
R4717:Sacs UTSW 14 61,450,304 (GRCm39) missense probably damaging 1.00
R4777:Sacs UTSW 14 61,449,258 (GRCm39) missense probably damaging 1.00
R4888:Sacs UTSW 14 61,449,647 (GRCm39) missense probably damaging 1.00
R4913:Sacs UTSW 14 61,451,246 (GRCm39) missense probably benign 0.17
R4973:Sacs UTSW 14 61,450,571 (GRCm39) missense probably damaging 1.00
R4986:Sacs UTSW 14 61,450,492 (GRCm39) nonsense probably null
R5090:Sacs UTSW 14 61,442,702 (GRCm39) missense probably damaging 1.00
R5243:Sacs UTSW 14 61,443,406 (GRCm39) nonsense probably null
R5292:Sacs UTSW 14 61,449,432 (GRCm39) missense probably damaging 1.00
R5308:Sacs UTSW 14 61,429,849 (GRCm39) missense probably benign 0.21
R5337:Sacs UTSW 14 61,430,963 (GRCm39) intron probably benign
R5502:Sacs UTSW 14 61,443,549 (GRCm39) missense probably damaging 1.00
R5586:Sacs UTSW 14 61,443,890 (GRCm39) nonsense probably null
R5692:Sacs UTSW 14 61,445,288 (GRCm39) missense probably benign 0.00
R5725:Sacs UTSW 14 61,448,559 (GRCm39) missense probably damaging 1.00
R5854:Sacs UTSW 14 61,448,996 (GRCm39) missense probably damaging 1.00
R5959:Sacs UTSW 14 61,449,849 (GRCm39) missense probably damaging 0.99
R5960:Sacs UTSW 14 61,446,144 (GRCm39) missense probably benign 0.30
R5968:Sacs UTSW 14 61,427,078 (GRCm39) missense probably damaging 0.99
R5983:Sacs UTSW 14 61,442,648 (GRCm39) missense probably damaging 1.00
R5992:Sacs UTSW 14 61,442,992 (GRCm39) missense probably damaging 1.00
R6076:Sacs UTSW 14 61,441,985 (GRCm39) nonsense probably null
R6175:Sacs UTSW 14 61,450,275 (GRCm39) missense possibly damaging 0.82
R6347:Sacs UTSW 14 61,448,609 (GRCm39) missense probably damaging 1.00
R6357:Sacs UTSW 14 61,446,273 (GRCm39) missense possibly damaging 0.47
R6415:Sacs UTSW 14 61,442,808 (GRCm39) missense probably damaging 1.00
R6469:Sacs UTSW 14 61,428,697 (GRCm39) missense probably damaging 1.00
R6503:Sacs UTSW 14 61,448,810 (GRCm39) missense probably benign 0.00
R6523:Sacs UTSW 14 61,440,410 (GRCm39) missense probably damaging 0.99
R6615:Sacs UTSW 14 61,446,383 (GRCm39) missense probably benign 0.15
R6729:Sacs UTSW 14 61,447,967 (GRCm39) missense probably damaging 1.00
R6731:Sacs UTSW 14 61,418,149 (GRCm39) splice site probably null
R6797:Sacs UTSW 14 61,450,522 (GRCm39) missense probably damaging 1.00
R6852:Sacs UTSW 14 61,416,737 (GRCm39) missense possibly damaging 0.87
R6922:Sacs UTSW 14 61,448,874 (GRCm39) missense probably damaging 1.00
R7023:Sacs UTSW 14 61,446,264 (GRCm39) missense probably benign 0.04
R7047:Sacs UTSW 14 61,450,451 (GRCm39) missense probably damaging 1.00
R7051:Sacs UTSW 14 61,446,377 (GRCm39) missense probably benign 0.25
R7069:Sacs UTSW 14 61,449,945 (GRCm39) missense probably damaging 1.00
R7082:Sacs UTSW 14 61,447,966 (GRCm39) missense possibly damaging 0.94
R7108:Sacs UTSW 14 61,448,458 (GRCm39) nonsense probably null
R7122:Sacs UTSW 14 61,447,845 (GRCm39) missense probably damaging 1.00
R7194:Sacs UTSW 14 61,447,538 (GRCm39) missense possibly damaging 0.95
R7214:Sacs UTSW 14 61,429,241 (GRCm39) missense probably benign
R7221:Sacs UTSW 14 61,446,255 (GRCm39) missense probably damaging 0.99
R7274:Sacs UTSW 14 61,451,530 (GRCm39) missense possibly damaging 0.88
R7344:Sacs UTSW 14 61,444,893 (GRCm39) missense possibly damaging 0.81
R7440:Sacs UTSW 14 61,429,054 (GRCm39) missense probably benign 0.10
R7474:Sacs UTSW 14 61,448,627 (GRCm39) missense probably benign 0.04
R7512:Sacs UTSW 14 61,441,879 (GRCm39) missense probably benign 0.04
R7641:Sacs UTSW 14 61,440,320 (GRCm39) missense probably damaging 0.97
R7649:Sacs UTSW 14 61,440,677 (GRCm39) missense possibly damaging 0.53
R7703:Sacs UTSW 14 61,443,539 (GRCm39) missense possibly damaging 0.81
R7792:Sacs UTSW 14 61,447,222 (GRCm39) missense probably benign 0.00
R7805:Sacs UTSW 14 61,441,040 (GRCm39) missense not run
R7822:Sacs UTSW 14 61,429,652 (GRCm39) missense probably benign 0.03
R7882:Sacs UTSW 14 61,444,520 (GRCm39) missense probably benign 0.02
R7932:Sacs UTSW 14 61,442,327 (GRCm39) missense probably damaging 0.99
R8031:Sacs UTSW 14 61,441,640 (GRCm39) missense probably damaging 0.96
R8064:Sacs UTSW 14 61,429,624 (GRCm39) missense possibly damaging 0.92
R8083:Sacs UTSW 14 61,448,166 (GRCm39) missense possibly damaging 0.77
R8204:Sacs UTSW 14 61,450,397 (GRCm39) missense probably damaging 0.96
R8293:Sacs UTSW 14 61,428,548 (GRCm39) missense probably damaging 0.99
R8316:Sacs UTSW 14 61,427,068 (GRCm39) missense possibly damaging 0.84
R8393:Sacs UTSW 14 61,410,655 (GRCm39) start codon destroyed probably null 0.06
R8434:Sacs UTSW 14 61,450,636 (GRCm39) nonsense probably null
R8482:Sacs UTSW 14 61,440,404 (GRCm39) missense probably benign
R8497:Sacs UTSW 14 61,429,702 (GRCm39) missense probably benign 0.00
R8557:Sacs UTSW 14 61,444,725 (GRCm39) missense probably damaging 1.00
R8698:Sacs UTSW 14 61,450,802 (GRCm39) missense probably benign
R8840:Sacs UTSW 14 61,429,177 (GRCm39) missense probably benign 0.25
R8924:Sacs UTSW 14 61,448,702 (GRCm39) missense probably damaging 1.00
R8924:Sacs UTSW 14 61,429,895 (GRCm39) missense probably benign 0.22
R8941:Sacs UTSW 14 61,430,022 (GRCm39) missense probably benign 0.00
R9007:Sacs UTSW 14 61,445,185 (GRCm39) missense probably benign 0.04
R9008:Sacs UTSW 14 61,441,992 (GRCm39) missense probably benign 0.19
R9070:Sacs UTSW 14 61,447,751 (GRCm39) missense probably benign
R9147:Sacs UTSW 14 61,450,137 (GRCm39) missense possibly damaging 0.86
R9185:Sacs UTSW 14 61,444,115 (GRCm39) missense probably damaging 0.98
R9290:Sacs UTSW 14 61,421,499 (GRCm39) missense probably benign 0.17
R9294:Sacs UTSW 14 61,477,768 (GRCm39) missense possibly damaging 0.84
R9339:Sacs UTSW 14 61,443,309 (GRCm39) missense probably benign 0.00
R9341:Sacs UTSW 14 61,446,219 (GRCm39) missense probably benign 0.08
R9343:Sacs UTSW 14 61,446,219 (GRCm39) missense probably benign 0.08
R9370:Sacs UTSW 14 61,441,080 (GRCm39) missense probably damaging 1.00
R9433:Sacs UTSW 14 61,443,997 (GRCm39) missense probably damaging 1.00
R9460:Sacs UTSW 14 61,441,611 (GRCm39) missense probably benign 0.34
R9548:Sacs UTSW 14 61,440,692 (GRCm39) missense probably benign 0.02
R9564:Sacs UTSW 14 61,449,046 (GRCm39) missense probably damaging 1.00
R9644:Sacs UTSW 14 61,443,428 (GRCm39) missense probably benign 0.00
R9683:Sacs UTSW 14 61,450,881 (GRCm39) missense possibly damaging 0.95
R9706:Sacs UTSW 14 61,445,822 (GRCm39) nonsense probably null
X0067:Sacs UTSW 14 61,445,468 (GRCm39) missense probably damaging 1.00
Z1176:Sacs UTSW 14 61,450,649 (GRCm39) missense probably damaging 1.00
Z1176:Sacs UTSW 14 61,448,279 (GRCm39) nonsense probably null
Z1177:Sacs UTSW 14 61,445,430 (GRCm39) missense possibly damaging 0.93
Z1177:Sacs UTSW 14 61,429,000 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTATGCAGTGTGGCCTGATC -3'
(R):5'- ATCAGAGGATCTCTAAGTTCTGC -3'

Sequencing Primer
(F):5'- CAGTGTGGCCTGATCCTGATC -3'
(R):5'- CTGCTTCAATTTCCTGGATATTAGG -3'
Posted On 2014-09-18