Incidental Mutation 'R2083:Tubgcp6'
ID230169
Institutional Source Beutler Lab
Gene Symbol Tubgcp6
Ensembl Gene ENSMUSG00000051786
Gene Nametubulin, gamma complex associated protein 6
Synonyms
MMRRC Submission 040088-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2083 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89098357-89123112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89122376 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 148 (Y148N)
Ref Sequence ENSEMBL: ENSMUSP00000104977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082197] [ENSMUST00000109347] [ENSMUST00000109353]
Predicted Effect probably damaging
Transcript: ENSMUST00000041656
AA Change: Y148N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: Y148N

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082197
SMART Domains Protein: ENSMUSP00000080832
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 322 2.1e-85 PFAM
low complexity region 478 489 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109347
SMART Domains Protein: ENSMUSP00000104971
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 251 6.1e-66 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109353
AA Change: Y148N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: Y148N

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231098
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,184,871 M73L possibly damaging Het
AA986860 A T 1: 130,741,069 I58F probably damaging Het
Acsl3 A T 1: 78,699,811 K507N probably damaging Het
Adcy3 T C 12: 4,173,512 Y245H probably damaging Het
Adgra1 T C 7: 139,875,631 S392P probably damaging Het
Ahnak C T 19: 9,011,557 P3402S probably damaging Het
Ambra1 T A 2: 91,766,600 I12N possibly damaging Het
Atp10b A G 11: 43,212,423 T545A probably benign Het
Atxn2 G T 5: 121,784,006 A638S probably benign Het
Cd109 T C 9: 78,667,293 S520P probably damaging Het
Col6a3 T C 1: 90,782,011 D1821G unknown Het
Cyp4a10 T C 4: 115,525,308 V265A possibly damaging Het
Dmrtb1 C T 4: 107,683,612 R184Q possibly damaging Het
Dnah7b A T 1: 46,241,067 I2719F possibly damaging Het
En2 T C 5: 28,167,073 S183P probably damaging Het
Etfb A G 7: 43,456,500 T101A probably benign Het
Etl4 T A 2: 20,743,549 S364T probably damaging Het
Fam196b A G 11: 34,402,141 D61G probably benign Het
Gm17728 C A 17: 9,422,289 S77Y possibly damaging Het
Golga4 A G 9: 118,532,590 E221G probably damaging Het
Gpr37 T C 6: 25,688,417 N227S possibly damaging Het
Kctd1 A T 18: 14,974,055 N784K possibly damaging Het
Klhl22 A G 16: 17,776,525 T173A probably benign Het
Ly6e T A 15: 74,958,319 C41S probably damaging Het
Mapkbp1 T C 2: 120,015,482 L444P possibly damaging Het
Mkx A T 18: 6,992,855 I143K probably damaging Het
Mlh3 A G 12: 85,269,041 F124L probably benign Het
Nlrp1a A T 11: 71,124,220 L68H possibly damaging Het
Obscn A C 11: 59,073,631 Y726* probably null Het
Olfr1312 C T 2: 112,042,553 V160I probably benign Het
Olfr26 T G 9: 38,855,341 V93G probably benign Het
Peak1 G A 9: 56,258,949 S565L probably damaging Het
Pter T A 2: 12,978,436 L84Q probably damaging Het
Ptpn4 A G 1: 119,687,759 L555P possibly damaging Het
Rpp40 A T 13: 35,898,992 M171K probably benign Het
Sacs A G 14: 61,206,506 I2000M possibly damaging Het
Scn5a T C 9: 119,492,123 I1458V probably benign Het
Slc38a4 T C 15: 97,008,993 D288G probably benign Het
Slc8a2 T G 7: 16,134,515 V224G probably damaging Het
Sptbn4 T C 7: 27,428,256 E173G probably benign Het
Tas1r1 T A 4: 152,028,391 H735L probably benign Het
Trps1 G T 15: 50,822,305 Q155K probably damaging Het
Tspyl5 T C 15: 33,686,746 H351R probably damaging Het
Ttf2 A T 3: 100,969,501 D21E probably benign Het
Ttll7 A G 3: 146,930,104 R398G possibly damaging Het
Vmn1r8 T A 6: 57,036,340 H125Q probably benign Het
Zfhx4 A G 3: 5,403,163 T2794A possibly damaging Het
Zfp27 T C 7: 29,894,783 I586V probably benign Het
Zfyve16 T C 13: 92,524,262 D13G probably damaging Het
Other mutations in Tubgcp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tubgcp6 APN 15 89104008 missense probably benign 0.00
IGL00556:Tubgcp6 APN 15 89100962 missense probably damaging 1.00
IGL00943:Tubgcp6 APN 15 89122397 nonsense probably null
IGL01284:Tubgcp6 APN 15 89110055 missense probably damaging 1.00
IGL01363:Tubgcp6 APN 15 89107525 missense probably damaging 1.00
IGL01386:Tubgcp6 APN 15 89107996 nonsense probably null
IGL01792:Tubgcp6 APN 15 89101281 missense probably damaging 1.00
IGL01866:Tubgcp6 APN 15 89103488 missense probably benign 0.01
IGL02596:Tubgcp6 APN 15 89100914 missense probably damaging 1.00
IGL02858:Tubgcp6 APN 15 89102315 nonsense probably null
IGL02873:Tubgcp6 APN 15 89103824 missense probably benign 0.00
IGL03400:Tubgcp6 APN 15 89108099 unclassified probably benign
IGL02796:Tubgcp6 UTSW 15 89122390 missense probably benign 0.03
R0010:Tubgcp6 UTSW 15 89103183 missense probably benign 0.00
R0308:Tubgcp6 UTSW 15 89122436 missense possibly damaging 0.85
R0440:Tubgcp6 UTSW 15 89103065 missense probably benign 0.12
R0631:Tubgcp6 UTSW 15 89100987 missense probably damaging 1.00
R1653:Tubgcp6 UTSW 15 89107442 missense probably damaging 1.00
R1901:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1902:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1905:Tubgcp6 UTSW 15 89100608 missense probably damaging 1.00
R2005:Tubgcp6 UTSW 15 89104166 missense probably benign 0.01
R2067:Tubgcp6 UTSW 15 89104489 missense probably benign 0.03
R2285:Tubgcp6 UTSW 15 89122474 missense probably damaging 1.00
R2401:Tubgcp6 UTSW 15 89102984 missense probably benign 0.22
R2436:Tubgcp6 UTSW 15 89102365 missense probably benign 0.37
R3017:Tubgcp6 UTSW 15 89103082 nonsense probably null
R3054:Tubgcp6 UTSW 15 89122603 missense probably damaging 1.00
R3932:Tubgcp6 UTSW 15 89104414 unclassified probably benign
R4350:Tubgcp6 UTSW 15 89103995 missense probably benign 0.00
R4472:Tubgcp6 UTSW 15 89103654 missense probably damaging 0.98
R4864:Tubgcp6 UTSW 15 89103818 missense probably benign
R4937:Tubgcp6 UTSW 15 89101549 missense probably damaging 0.98
R4983:Tubgcp6 UTSW 15 89106291 missense probably damaging 1.00
R4996:Tubgcp6 UTSW 15 89103490 missense possibly damaging 0.89
R5044:Tubgcp6 UTSW 15 89099545 unclassified probably benign
R5122:Tubgcp6 UTSW 15 89116103 missense probably damaging 1.00
R5607:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5608:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5653:Tubgcp6 UTSW 15 89108612 missense possibly damaging 0.47
R5886:Tubgcp6 UTSW 15 89103247 missense possibly damaging 0.82
R5945:Tubgcp6 UTSW 15 89109217 splice site probably null
R6111:Tubgcp6 UTSW 15 89100920 missense possibly damaging 0.83
R6195:Tubgcp6 UTSW 15 89122791 missense probably benign 0.01
R6792:Tubgcp6 UTSW 15 89122877 start gained probably benign
R7074:Tubgcp6 UTSW 15 89120636 missense probably damaging 1.00
R7103:Tubgcp6 UTSW 15 89101029 missense probably damaging 0.96
R7274:Tubgcp6 UTSW 15 89102970 nonsense probably null
R7275:Tubgcp6 UTSW 15 89102943 nonsense probably null
R7514:Tubgcp6 UTSW 15 89120525 missense probably damaging 1.00
R7540:Tubgcp6 UTSW 15 89102323 missense possibly damaging 0.48
R7571:Tubgcp6 UTSW 15 89100722 missense probably damaging 1.00
R7706:Tubgcp6 UTSW 15 89104223 missense probably benign
R7721:Tubgcp6 UTSW 15 89101401 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCATAGGTGCGGCTATGC -3'
(R):5'- GCTCGTGGAGAAACTTGAAGC -3'

Sequencing Primer
(F):5'- TGCGGCTATGCACAAGTG -3'
(R):5'- TTGAAGCAGCCCCTGACTGTC -3'
Posted On2014-09-18