Incidental Mutation 'R2083:Tubgcp6'
ID 230169
Institutional Source Beutler Lab
Gene Symbol Tubgcp6
Ensembl Gene ENSMUSG00000051786
Gene Name tubulin, gamma complex component 6
Synonyms
MMRRC Submission 040088-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 88983300-89007411 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89006579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 148 (Y148N)
Ref Sequence ENSEMBL: ENSMUSP00000104977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082197] [ENSMUST00000109347] [ENSMUST00000109353]
AlphaFold G5E8P0
Predicted Effect probably damaging
Transcript: ENSMUST00000041656
AA Change: Y148N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: Y148N

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082197
SMART Domains Protein: ENSMUSP00000080832
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 322 2.1e-85 PFAM
low complexity region 478 489 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109347
SMART Domains Protein: ENSMUSP00000104971
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 251 6.1e-66 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109353
AA Change: Y148N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: Y148N

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231098
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,121,681 (GRCm39) M73L possibly damaging Het
AA986860 A T 1: 130,668,806 (GRCm39) I58F probably damaging Het
Acsl3 A T 1: 78,677,528 (GRCm39) K507N probably damaging Het
Adcy3 T C 12: 4,223,512 (GRCm39) Y245H probably damaging Het
Adgra1 T C 7: 139,455,547 (GRCm39) S392P probably damaging Het
Ahnak C T 19: 8,988,921 (GRCm39) P3402S probably damaging Het
Ambra1 T A 2: 91,596,945 (GRCm39) I12N possibly damaging Het
Atp10b A G 11: 43,103,250 (GRCm39) T545A probably benign Het
Atxn2 G T 5: 121,922,069 (GRCm39) A638S probably benign Het
Cd109 T C 9: 78,574,575 (GRCm39) S520P probably damaging Het
Col6a3 T C 1: 90,709,733 (GRCm39) D1821G unknown Het
Cyp4a10 T C 4: 115,382,505 (GRCm39) V265A possibly damaging Het
Dmrtb1 C T 4: 107,540,809 (GRCm39) R184Q possibly damaging Het
Dnah7b A T 1: 46,280,227 (GRCm39) I2719F possibly damaging Het
En2 T C 5: 28,372,071 (GRCm39) S183P probably damaging Het
Etfb A G 7: 43,105,924 (GRCm39) T101A probably benign Het
Etl4 T A 2: 20,748,360 (GRCm39) S364T probably damaging Het
Gm17728 C A 17: 9,641,121 (GRCm39) S77Y possibly damaging Het
Golga4 A G 9: 118,361,658 (GRCm39) E221G probably damaging Het
Gpr37 T C 6: 25,688,416 (GRCm39) N227S possibly damaging Het
Insyn2b A G 11: 34,352,141 (GRCm39) D61G probably benign Het
Kctd1 A T 18: 15,107,112 (GRCm39) N784K possibly damaging Het
Klhl22 A G 16: 17,594,389 (GRCm39) T173A probably benign Het
Ly6e T A 15: 74,830,168 (GRCm39) C41S probably damaging Het
Mapkbp1 T C 2: 119,845,963 (GRCm39) L444P possibly damaging Het
Mkx A T 18: 6,992,855 (GRCm39) I143K probably damaging Het
Mlh3 A G 12: 85,315,815 (GRCm39) F124L probably benign Het
Nlrp1a A T 11: 71,015,046 (GRCm39) L68H possibly damaging Het
Obscn A C 11: 58,964,457 (GRCm39) Y726* probably null Het
Or4f59 C T 2: 111,872,898 (GRCm39) V160I probably benign Het
Or8d1 T G 9: 38,766,637 (GRCm39) V93G probably benign Het
Peak1 G A 9: 56,166,233 (GRCm39) S565L probably damaging Het
Pter T A 2: 12,983,247 (GRCm39) L84Q probably damaging Het
Ptpn4 A G 1: 119,615,489 (GRCm39) L555P possibly damaging Het
Rpp40 A T 13: 36,082,975 (GRCm39) M171K probably benign Het
Sacs A G 14: 61,443,955 (GRCm39) I2000M possibly damaging Het
Scn5a T C 9: 119,321,189 (GRCm39) I1458V probably benign Het
Slc38a4 T C 15: 96,906,874 (GRCm39) D288G probably benign Het
Slc8a2 T G 7: 15,868,440 (GRCm39) V224G probably damaging Het
Sptbn4 T C 7: 27,127,681 (GRCm39) E173G probably benign Het
Tas1r1 T A 4: 152,112,848 (GRCm39) H735L probably benign Het
Trps1 G T 15: 50,685,701 (GRCm39) Q155K probably damaging Het
Tspyl5 T C 15: 33,686,892 (GRCm39) H351R probably damaging Het
Ttf2 A T 3: 100,876,817 (GRCm39) D21E probably benign Het
Ttll7 A G 3: 146,635,859 (GRCm39) R398G possibly damaging Het
Vmn1r8 T A 6: 57,013,325 (GRCm39) H125Q probably benign Het
Zfhx4 A G 3: 5,468,223 (GRCm39) T2794A possibly damaging Het
Zfp27 T C 7: 29,594,208 (GRCm39) I586V probably benign Het
Zfyve16 T C 13: 92,660,770 (GRCm39) D13G probably damaging Het
Other mutations in Tubgcp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tubgcp6 APN 15 88,988,211 (GRCm39) missense probably benign 0.00
IGL00556:Tubgcp6 APN 15 88,985,165 (GRCm39) missense probably damaging 1.00
IGL00943:Tubgcp6 APN 15 89,006,600 (GRCm39) nonsense probably null
IGL01284:Tubgcp6 APN 15 88,994,258 (GRCm39) missense probably damaging 1.00
IGL01363:Tubgcp6 APN 15 88,991,728 (GRCm39) missense probably damaging 1.00
IGL01386:Tubgcp6 APN 15 88,992,199 (GRCm39) nonsense probably null
IGL01792:Tubgcp6 APN 15 88,985,484 (GRCm39) missense probably damaging 1.00
IGL01866:Tubgcp6 APN 15 88,987,691 (GRCm39) missense probably benign 0.01
IGL02596:Tubgcp6 APN 15 88,985,117 (GRCm39) missense probably damaging 1.00
IGL02858:Tubgcp6 APN 15 88,986,518 (GRCm39) nonsense probably null
IGL02873:Tubgcp6 APN 15 88,988,027 (GRCm39) missense probably benign 0.00
IGL03400:Tubgcp6 APN 15 88,992,302 (GRCm39) unclassified probably benign
IGL02796:Tubgcp6 UTSW 15 89,006,593 (GRCm39) missense probably benign 0.03
R0010:Tubgcp6 UTSW 15 88,987,386 (GRCm39) missense probably benign 0.00
R0308:Tubgcp6 UTSW 15 89,006,639 (GRCm39) missense possibly damaging 0.85
R0440:Tubgcp6 UTSW 15 88,987,268 (GRCm39) missense probably benign 0.12
R0631:Tubgcp6 UTSW 15 88,985,190 (GRCm39) missense probably damaging 1.00
R1653:Tubgcp6 UTSW 15 88,991,645 (GRCm39) missense probably damaging 1.00
R1901:Tubgcp6 UTSW 15 89,000,444 (GRCm39) missense possibly damaging 0.68
R1902:Tubgcp6 UTSW 15 89,000,444 (GRCm39) missense possibly damaging 0.68
R1905:Tubgcp6 UTSW 15 88,984,811 (GRCm39) missense probably damaging 1.00
R2005:Tubgcp6 UTSW 15 88,988,369 (GRCm39) missense probably benign 0.01
R2067:Tubgcp6 UTSW 15 88,988,692 (GRCm39) missense probably benign 0.03
R2285:Tubgcp6 UTSW 15 89,006,677 (GRCm39) missense probably damaging 1.00
R2401:Tubgcp6 UTSW 15 88,987,187 (GRCm39) missense probably benign 0.22
R2436:Tubgcp6 UTSW 15 88,986,568 (GRCm39) missense probably benign 0.37
R3017:Tubgcp6 UTSW 15 88,987,285 (GRCm39) nonsense probably null
R3054:Tubgcp6 UTSW 15 89,006,806 (GRCm39) missense probably damaging 1.00
R3932:Tubgcp6 UTSW 15 88,988,617 (GRCm39) unclassified probably benign
R4350:Tubgcp6 UTSW 15 88,988,198 (GRCm39) missense probably benign 0.00
R4472:Tubgcp6 UTSW 15 88,987,857 (GRCm39) missense probably damaging 0.98
R4864:Tubgcp6 UTSW 15 88,988,021 (GRCm39) missense probably benign
R4937:Tubgcp6 UTSW 15 88,985,752 (GRCm39) missense probably damaging 0.98
R4983:Tubgcp6 UTSW 15 88,990,494 (GRCm39) missense probably damaging 1.00
R4996:Tubgcp6 UTSW 15 88,987,693 (GRCm39) missense possibly damaging 0.89
R5044:Tubgcp6 UTSW 15 88,983,748 (GRCm39) unclassified probably benign
R5122:Tubgcp6 UTSW 15 89,000,306 (GRCm39) missense probably damaging 1.00
R5607:Tubgcp6 UTSW 15 88,995,353 (GRCm39) missense probably benign 0.02
R5608:Tubgcp6 UTSW 15 88,995,353 (GRCm39) missense probably benign 0.02
R5653:Tubgcp6 UTSW 15 88,992,815 (GRCm39) missense possibly damaging 0.47
R5886:Tubgcp6 UTSW 15 88,987,450 (GRCm39) missense possibly damaging 0.82
R5945:Tubgcp6 UTSW 15 88,993,420 (GRCm39) splice site probably null
R6111:Tubgcp6 UTSW 15 88,985,123 (GRCm39) missense possibly damaging 0.83
R6195:Tubgcp6 UTSW 15 89,006,994 (GRCm39) missense probably benign 0.01
R6792:Tubgcp6 UTSW 15 89,007,080 (GRCm39) start gained probably benign
R7074:Tubgcp6 UTSW 15 89,004,839 (GRCm39) missense probably damaging 1.00
R7103:Tubgcp6 UTSW 15 88,985,232 (GRCm39) missense probably damaging 0.96
R7274:Tubgcp6 UTSW 15 88,987,173 (GRCm39) nonsense probably null
R7275:Tubgcp6 UTSW 15 88,987,146 (GRCm39) nonsense probably null
R7514:Tubgcp6 UTSW 15 89,004,728 (GRCm39) missense probably damaging 1.00
R7540:Tubgcp6 UTSW 15 88,986,526 (GRCm39) missense possibly damaging 0.48
R7571:Tubgcp6 UTSW 15 88,984,925 (GRCm39) missense probably damaging 1.00
R7706:Tubgcp6 UTSW 15 88,988,426 (GRCm39) missense probably benign
R7721:Tubgcp6 UTSW 15 88,985,604 (GRCm39) missense probably damaging 1.00
R7980:Tubgcp6 UTSW 15 88,986,232 (GRCm39) missense probably benign 0.03
R7996:Tubgcp6 UTSW 15 88,993,231 (GRCm39) missense possibly damaging 0.92
R8095:Tubgcp6 UTSW 15 89,006,977 (GRCm39) missense probably benign 0.07
R8191:Tubgcp6 UTSW 15 89,004,843 (GRCm39) missense probably damaging 1.00
R8510:Tubgcp6 UTSW 15 88,987,152 (GRCm39) missense possibly damaging 0.91
R8839:Tubgcp6 UTSW 15 88,987,681 (GRCm39) missense possibly damaging 0.91
R8862:Tubgcp6 UTSW 15 89,006,824 (GRCm39) missense probably benign 0.03
R9044:Tubgcp6 UTSW 15 88,987,397 (GRCm39) missense possibly damaging 0.89
R9321:Tubgcp6 UTSW 15 88,992,186 (GRCm39) missense probably damaging 1.00
R9402:Tubgcp6 UTSW 15 88,987,064 (GRCm39) missense probably benign 0.01
R9428:Tubgcp6 UTSW 15 88,985,100 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCATAGGTGCGGCTATGC -3'
(R):5'- GCTCGTGGAGAAACTTGAAGC -3'

Sequencing Primer
(F):5'- TGCGGCTATGCACAAGTG -3'
(R):5'- TTGAAGCAGCCCCTGACTGTC -3'
Posted On 2014-09-18