Incidental Mutation 'R2083:Slc38a4'
ID 230170
Institutional Source Beutler Lab
Gene Symbol Slc38a4
Ensembl Gene ENSMUSG00000022464
Gene Name solute carrier family 38, member 4
Synonyms Ata3, SNAT4, 1700012A18Rik, 1110012E16Rik
MMRRC Submission 040088-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R2083 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 96892701-96953837 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96906874 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 288 (D288G)
Ref Sequence ENSEMBL: ENSMUSP00000155158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023101] [ENSMUST00000166223] [ENSMUST00000230086] [ENSMUST00000230907] [ENSMUST00000231039]
AlphaFold Q8R1S9
Predicted Effect probably benign
Transcript: ENSMUST00000023101
AA Change: D288G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023101
Gene: ENSMUSG00000022464
AA Change: D288G

DomainStartEndE-ValueType
Pfam:Aa_trans 73 263 4.9e-38 PFAM
Pfam:Aa_trans 302 535 2.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166223
AA Change: D288G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127676
Gene: ENSMUSG00000022464
AA Change: D288G

DomainStartEndE-ValueType
Pfam:Aa_trans 73 262 2.5e-38 PFAM
Pfam:Aa_trans 303 535 2.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230086
AA Change: D288G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000230907
Predicted Effect probably benign
Transcript: ENSMUST00000231039
AA Change: D288G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC38A4 is found predominantly in liver and transports both cationic and neutral amino acids. The transport of cationic amino acids by SLC38A4 is Na(+) and pH independent, while the transport of neutral amino acids is Na(+) and pH dependent (Hatanaka et al., 2001 [PubMed 11342143]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T A 5: 146,121,681 (GRCm39) M73L possibly damaging Het
AA986860 A T 1: 130,668,806 (GRCm39) I58F probably damaging Het
Acsl3 A T 1: 78,677,528 (GRCm39) K507N probably damaging Het
Adcy3 T C 12: 4,223,512 (GRCm39) Y245H probably damaging Het
Adgra1 T C 7: 139,455,547 (GRCm39) S392P probably damaging Het
Ahnak C T 19: 8,988,921 (GRCm39) P3402S probably damaging Het
Ambra1 T A 2: 91,596,945 (GRCm39) I12N possibly damaging Het
Atp10b A G 11: 43,103,250 (GRCm39) T545A probably benign Het
Atxn2 G T 5: 121,922,069 (GRCm39) A638S probably benign Het
Cd109 T C 9: 78,574,575 (GRCm39) S520P probably damaging Het
Col6a3 T C 1: 90,709,733 (GRCm39) D1821G unknown Het
Cyp4a10 T C 4: 115,382,505 (GRCm39) V265A possibly damaging Het
Dmrtb1 C T 4: 107,540,809 (GRCm39) R184Q possibly damaging Het
Dnah7b A T 1: 46,280,227 (GRCm39) I2719F possibly damaging Het
En2 T C 5: 28,372,071 (GRCm39) S183P probably damaging Het
Etfb A G 7: 43,105,924 (GRCm39) T101A probably benign Het
Etl4 T A 2: 20,748,360 (GRCm39) S364T probably damaging Het
Gm17728 C A 17: 9,641,121 (GRCm39) S77Y possibly damaging Het
Golga4 A G 9: 118,361,658 (GRCm39) E221G probably damaging Het
Gpr37 T C 6: 25,688,416 (GRCm39) N227S possibly damaging Het
Insyn2b A G 11: 34,352,141 (GRCm39) D61G probably benign Het
Kctd1 A T 18: 15,107,112 (GRCm39) N784K possibly damaging Het
Klhl22 A G 16: 17,594,389 (GRCm39) T173A probably benign Het
Ly6e T A 15: 74,830,168 (GRCm39) C41S probably damaging Het
Mapkbp1 T C 2: 119,845,963 (GRCm39) L444P possibly damaging Het
Mkx A T 18: 6,992,855 (GRCm39) I143K probably damaging Het
Mlh3 A G 12: 85,315,815 (GRCm39) F124L probably benign Het
Nlrp1a A T 11: 71,015,046 (GRCm39) L68H possibly damaging Het
Obscn A C 11: 58,964,457 (GRCm39) Y726* probably null Het
Or4f59 C T 2: 111,872,898 (GRCm39) V160I probably benign Het
Or8d1 T G 9: 38,766,637 (GRCm39) V93G probably benign Het
Peak1 G A 9: 56,166,233 (GRCm39) S565L probably damaging Het
Pter T A 2: 12,983,247 (GRCm39) L84Q probably damaging Het
Ptpn4 A G 1: 119,615,489 (GRCm39) L555P possibly damaging Het
Rpp40 A T 13: 36,082,975 (GRCm39) M171K probably benign Het
Sacs A G 14: 61,443,955 (GRCm39) I2000M possibly damaging Het
Scn5a T C 9: 119,321,189 (GRCm39) I1458V probably benign Het
Slc8a2 T G 7: 15,868,440 (GRCm39) V224G probably damaging Het
Sptbn4 T C 7: 27,127,681 (GRCm39) E173G probably benign Het
Tas1r1 T A 4: 152,112,848 (GRCm39) H735L probably benign Het
Trps1 G T 15: 50,685,701 (GRCm39) Q155K probably damaging Het
Tspyl5 T C 15: 33,686,892 (GRCm39) H351R probably damaging Het
Ttf2 A T 3: 100,876,817 (GRCm39) D21E probably benign Het
Ttll7 A G 3: 146,635,859 (GRCm39) R398G possibly damaging Het
Tubgcp6 A T 15: 89,006,579 (GRCm39) Y148N probably damaging Het
Vmn1r8 T A 6: 57,013,325 (GRCm39) H125Q probably benign Het
Zfhx4 A G 3: 5,468,223 (GRCm39) T2794A possibly damaging Het
Zfp27 T C 7: 29,594,208 (GRCm39) I586V probably benign Het
Zfyve16 T C 13: 92,660,770 (GRCm39) D13G probably damaging Het
Other mutations in Slc38a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Slc38a4 APN 15 96,917,690 (GRCm39) missense probably benign 0.01
IGL00229:Slc38a4 APN 15 96,897,375 (GRCm39) missense probably damaging 0.99
IGL00974:Slc38a4 APN 15 96,897,397 (GRCm39) missense probably benign 0.05
IGL01951:Slc38a4 APN 15 96,917,644 (GRCm39) missense probably benign 0.07
R0012:Slc38a4 UTSW 15 96,897,510 (GRCm39) missense probably damaging 1.00
R0012:Slc38a4 UTSW 15 96,897,510 (GRCm39) missense probably damaging 1.00
R0165:Slc38a4 UTSW 15 96,906,830 (GRCm39) missense probably benign 0.00
R0304:Slc38a4 UTSW 15 96,906,335 (GRCm39) missense probably damaging 1.00
R0543:Slc38a4 UTSW 15 96,914,720 (GRCm39) missense possibly damaging 0.52
R0973:Slc38a4 UTSW 15 96,903,739 (GRCm39) missense probably benign 0.04
R0973:Slc38a4 UTSW 15 96,903,739 (GRCm39) missense probably benign 0.04
R0974:Slc38a4 UTSW 15 96,903,739 (GRCm39) missense probably benign 0.04
R1340:Slc38a4 UTSW 15 96,908,153 (GRCm39) splice site probably benign
R1973:Slc38a4 UTSW 15 96,897,478 (GRCm39) missense probably benign 0.36
R2058:Slc38a4 UTSW 15 96,906,606 (GRCm39) missense probably benign 0.22
R2108:Slc38a4 UTSW 15 96,906,878 (GRCm39) missense probably benign
R3908:Slc38a4 UTSW 15 96,910,875 (GRCm39) critical splice acceptor site probably null
R4037:Slc38a4 UTSW 15 96,894,923 (GRCm39) missense probably benign 0.03
R4259:Slc38a4 UTSW 15 96,896,374 (GRCm39) missense probably damaging 1.00
R4260:Slc38a4 UTSW 15 96,896,374 (GRCm39) missense probably damaging 1.00
R4261:Slc38a4 UTSW 15 96,896,374 (GRCm39) missense probably damaging 1.00
R4370:Slc38a4 UTSW 15 96,906,965 (GRCm39) missense possibly damaging 0.48
R4435:Slc38a4 UTSW 15 96,906,899 (GRCm39) missense probably benign
R5289:Slc38a4 UTSW 15 96,908,229 (GRCm39) missense possibly damaging 0.72
R5638:Slc38a4 UTSW 15 96,910,871 (GRCm39) missense probably damaging 0.99
R5893:Slc38a4 UTSW 15 96,897,432 (GRCm39) missense probably benign 0.23
R7059:Slc38a4 UTSW 15 96,906,895 (GRCm39) nonsense probably null
R7223:Slc38a4 UTSW 15 96,908,226 (GRCm39) missense probably damaging 1.00
R7267:Slc38a4 UTSW 15 96,903,781 (GRCm39) missense probably benign 0.01
R7768:Slc38a4 UTSW 15 96,906,545 (GRCm39) missense probably damaging 1.00
R7903:Slc38a4 UTSW 15 96,906,809 (GRCm39) missense probably benign 0.03
R8314:Slc38a4 UTSW 15 96,908,190 (GRCm39) missense probably benign 0.10
R8385:Slc38a4 UTSW 15 96,897,393 (GRCm39) missense probably damaging 1.00
R8822:Slc38a4 UTSW 15 96,906,952 (GRCm39) missense probably benign 0.12
R8955:Slc38a4 UTSW 15 96,914,662 (GRCm39) missense probably benign
R8962:Slc38a4 UTSW 15 96,917,684 (GRCm39) missense probably benign 0.00
R9000:Slc38a4 UTSW 15 96,897,475 (GRCm39) missense possibly damaging 0.48
R9043:Slc38a4 UTSW 15 96,906,805 (GRCm39) missense possibly damaging 0.93
R9760:Slc38a4 UTSW 15 96,896,332 (GRCm39) missense probably damaging 1.00
R9786:Slc38a4 UTSW 15 96,906,378 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCGACCACAGTACTCAGTG -3'
(R):5'- ACAGATTTTAATCCCATCGCTTGC -3'

Sequencing Primer
(F):5'- ACAGTACTCAGTGCCTTAGGG -3'
(R):5'- TCTGGATCACAACAACGG -3'
Posted On 2014-09-18