Mutagenetix > Incidental Mutation

Incidental Mutation 'R2084:Trmt1l'

230177

Institutional Source

Beutler Lab

Gene Symbol

Trmt1l

Ensembl Gene

ENSMUSG00000053286

Gene Name

tRNA methyltransferase 1 like

Synonyms

Trm1-like, 1190005F20Rik

MMRRC Submission

040089-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2084 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

151428542-151458161 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 151440854 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 189 (T189A)

Ref Sequence

ENSEMBL: ENSMUSP00000068309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000065625
AA Change: T189A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: T189A

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	25	70	N/A	INTRINSIC
ZnF_C2H2	116	142	7.49e0	SMART
ZnF_C2H2	181	203	2.49e-1	SMART
Pfam:TRM	220	563	6.9e-60	PFAM
Pfam:TRM	595	684	6.8e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188179

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188679

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188843

Predicted Effect

probably damaging
Transcript: ENSMUST00000189655
AA Change: T36A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286
AA Change: T36A

Domain	Start	End	E-Value	Type
ZnF_C2H2	28	50	1.1e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192826

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198467

Meta Mutation Damage Score

0.1860

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	C	14: 8,558,171	D138G	probably damaging	Het
9530053A07Rik	G	A	7: 28,157,535	V2103M	probably damaging	Het
Ankrd36	C	T	11: 5,662,378	Q1237*	probably null	Het
Aph1c	T	G	9: 66,819,297	R258S	probably damaging	Het
Arfgap3	T	A	15: 83,334,566	N102I	probably damaging	Het
Astn1	T	C	1: 158,472,408	V106A	probably damaging	Het
BC005537	G	T	13: 24,812,715		probably null	Het
Card10	G	A	15: 78,792,971	T412M	possibly damaging	Het
Cars	T	C	7: 143,587,182	I126M	probably benign	Het
Col11a1	C	T	3: 114,158,142	R1074C	probably damaging	Het
Cpped1	T	C	16: 11,828,501	D153G	probably damaging	Het
Cyp2j11	T	A	4: 96,339,201	I193F	probably damaging	Het
Dnm2	T	C	9: 21,500,371		probably null	Het
Efemp1	A	G	11: 28,915,763	D288G	probably damaging	Het
Espl1	T	C	15: 102,296,851		probably null	Het
Fcrl5	T	C	3: 87,444,230	F262L	probably benign	Het
Gh	G	A	11: 106,301,132	P84L	probably damaging	Het
Gm10267	T	C	18: 44,157,330	R37G	probably benign	Het
Gm13089	T	A	4: 143,699,350	T8S	probably damaging	Het
Hmgxb3	C	T	18: 61,155,023		probably benign	Het
Ifit2	T	C	19: 34,573,350	W97R	probably damaging	Het
Ift81	T	G	5: 122,567,347	K491Q	probably benign	Het
Ints8	A	G	4: 11,230,377	V488A	probably benign	Het
Krba1	T	A	6: 48,414,568	L797Q	probably damaging	Het
Krr1	T	C	10: 111,976,785	V100A	probably damaging	Het
Nav1	C	T	1: 135,607,420		probably benign	Het
Nos1	C	A	5: 117,943,245	Q1205K	probably damaging	Het
Nup85	A	T	11: 115,568,691	D125V	possibly damaging	Het
Olfr993	T	C	2: 85,414,615	E88G	probably benign	Het
Pclo	T	G	5: 14,682,148	S3555A	probably benign	Het
Pdzrn3	T	C	6: 101,154,295	I473V	probably benign	Het
Polr1a	A	G	6: 71,950,809	E848G	possibly damaging	Het
Pop1	T	C	15: 34,508,598		probably benign	Het
Prpf3	C	T	3: 95,848,989	E117K	probably benign	Het
Psmg3	C	T	5: 139,823,989	V101M	probably benign	Het
Rexo1	G	A	10: 80,561,266	S52L	probably benign	Het
Ryk	C	T	9: 102,875,772	T210M	probably damaging	Het
Sde2	A	G	1: 180,862,633	E306G	probably damaging	Het
Sec24c	A	G	14: 20,691,279	Q658R	probably benign	Het
Sgsm1	G	A	5: 113,285,400	T183I	probably damaging	Het
Skint7	T	A	4: 111,980,178	V51E	probably damaging	Het
Slc6a5	T	A	7: 49,948,254	M622K	probably benign	Het
Slco1a5	T	C	6: 142,234,711	H655R	probably benign	Het
Slco1c1	T	A	6: 141,559,852	Y452*	probably null	Het
Spn	T	C	7: 127,137,038	E99G	probably benign	Het
Ssc5d	A	G	7: 4,937,012	I789V	probably benign	Het
Taok2	G	A	7: 126,870,191	T1155I	probably benign	Het
Tet2	T	C	3: 133,487,767	Q302R	possibly damaging	Het
Tubal3	T	C	13: 3,928,192	I36T	possibly damaging	Het
Vmn2r71	A	T	7: 85,618,737	Y133F	probably benign	Het
Vps11	G	T	9: 44,353,261	H673N	probably benign	Het
Zc3h12a	C	T	4: 125,120,009	S354N	probably benign	Het
Zfp2	A	G	11: 50,900,962	S85P	probably benign	Het

Other mutations in Trmt1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Trmt1l	APN	1	151442712	critical splice donor site	probably null
IGL02175:Trmt1l	APN	1	151448484	missense	probably benign	0.00
IGL02348:Trmt1l	APN	1	151450006	missense	probably damaging	1.00
IGL02397:Trmt1l	APN	1	151439531	missense	probably damaging	1.00
IGL02582:Trmt1l	APN	1	151433785	splice site	probably benign
IGL03150:Trmt1l	APN	1	151453892	missense	probably benign	0.00
IGL03220:Trmt1l	APN	1	151440941	splice site	probably benign
Canyonlands	UTSW	1	151454048	nonsense	probably null
splendiforous	UTSW	1	151453148	missense	probably damaging	1.00
IGL03014:Trmt1l	UTSW	1	151457930	missense	probably damaging	0.99
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0240:Trmt1l	UTSW	1	151457454	unclassified	probably benign
R0267:Trmt1l	UTSW	1	151457675	unclassified	probably benign
R2206:Trmt1l	UTSW	1	151435843	critical splice donor site	probably null
R2338:Trmt1l	UTSW	1	151428959	intron	probably benign
R2408:Trmt1l	UTSW	1	151439516	missense	possibly damaging	0.48
R2429:Trmt1l	UTSW	1	151433830	missense	probably damaging	1.00
R2520:Trmt1l	UTSW	1	151453945	missense	probably benign	0.14
R3972:Trmt1l	UTSW	1	151433883	missense	possibly damaging	0.91
R4092:Trmt1l	UTSW	1	151455033	missense	probably benign	0.18
R4361:Trmt1l	UTSW	1	151435875	intron	probably benign
R4411:Trmt1l	UTSW	1	151452154	missense	probably benign	0.02
R4419:Trmt1l	UTSW	1	151440808	missense	probably damaging	0.98
R4518:Trmt1l	UTSW	1	151448343	nonsense	probably null
R4614:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4617:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4618:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4647:Trmt1l	UTSW	1	151457881	missense	possibly damaging	0.86
R4653:Trmt1l	UTSW	1	151439569	missense	probably benign	0.00
R4734:Trmt1l	UTSW	1	151442637	missense	probably benign	0.32
R4873:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R4875:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R5026:Trmt1l	UTSW	1	151440876	missense	probably damaging	1.00
R5528:Trmt1l	UTSW	1	151454995	missense	probably benign
R5587:Trmt1l	UTSW	1	151435704	intron	probably benign
R5872:Trmt1l	UTSW	1	151440843	missense	probably damaging	1.00
R6060:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
R6169:Trmt1l	UTSW	1	151428953	intron	probably benign
R6333:Trmt1l	UTSW	1	151453934	missense	probably benign	0.15
R6906:Trmt1l	UTSW	1	151452175	missense	probably benign	0.03
R7269:Trmt1l	UTSW	1	151457788	missense	possibly damaging	0.81
R7574:Trmt1l	UTSW	1	151440840	missense	possibly damaging	0.95
R7740:Trmt1l	UTSW	1	151440888	missense	possibly damaging	0.47
R7760:Trmt1l	UTSW	1	151442674	missense	possibly damaging	0.93
R7984:Trmt1l	UTSW	1	151435738	missense	probably benign	0.02
R8257:Trmt1l	UTSW	1	151428878	start codon destroyed	probably null
R8286:Trmt1l	UTSW	1	151457792	missense	probably damaging	1.00
R8439:Trmt1l	UTSW	1	151449976	missense	probably benign	0.10
R8451:Trmt1l	UTSW	1	151448288	missense	unknown
R8514:Trmt1l	UTSW	1	151453991	missense	probably damaging	0.98
R9287:Trmt1l	UTSW	1	151453148	missense	probably damaging	1.00
R9423:Trmt1l	UTSW	1	151450066	missense	possibly damaging	0.90
R9622:Trmt1l	UTSW	1	151428959	nonsense	probably null
X0039:Trmt1l	UTSW	1	151454990	missense	possibly damaging	0.88
Z1176:Trmt1l	UTSW	1	151453113	missense	possibly damaging	0.72
Z1187:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1189:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1190:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1192:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GGTACATCAGGAAATTAACATCACC -3'
(R):5'- GGGTACTGATGTGAAAACATGATACTG -3'

Sequencing Primer
(F):5'- TCACCTTTTACACTGTTAAATCCAG -3'
(R):5'- AAGAGCACTGACTGTTCTGC -3'

Posted On

2014-09-18