Incidental Mutation 'R2084:Olfr993'
ID230180
Institutional Source Beutler Lab
Gene Symbol Olfr993
Ensembl Gene ENSMUSG00000075220
Gene Nameolfactory receptor 993
SynonymsGA_x6K02T2Q125-46891524-46890580, MOR203-2
MMRRC Submission 040089-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R2084 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85413933-85414877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85414615 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 88 (E88G)
Ref Sequence ENSEMBL: ENSMUSP00000097510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099926]
Predicted Effect probably benign
Transcript: ENSMUST00000099926
AA Change: E88G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097510
Gene: ENSMUSG00000075220
AA Change: E88G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 1.3e-7 PFAM
Pfam:7tm_1 41 290 2.2e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T C 14: 8,558,171 D138G probably damaging Het
9530053A07Rik G A 7: 28,157,535 V2103M probably damaging Het
Ankrd36 C T 11: 5,662,378 Q1237* probably null Het
Aph1c T G 9: 66,819,297 R258S probably damaging Het
Arfgap3 T A 15: 83,334,566 N102I probably damaging Het
Astn1 T C 1: 158,472,408 V106A probably damaging Het
BC005537 G T 13: 24,812,715 probably null Het
Card10 G A 15: 78,792,971 T412M possibly damaging Het
Cars T C 7: 143,587,182 I126M probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Cpped1 T C 16: 11,828,501 D153G probably damaging Het
Cyp2j11 T A 4: 96,339,201 I193F probably damaging Het
Dnm2 T C 9: 21,500,371 probably null Het
Efemp1 A G 11: 28,915,763 D288G probably damaging Het
Espl1 T C 15: 102,296,851 probably null Het
Fcrl5 T C 3: 87,444,230 F262L probably benign Het
Gh G A 11: 106,301,132 P84L probably damaging Het
Gm10267 T C 18: 44,157,330 R37G probably benign Het
Gm13089 T A 4: 143,699,350 T8S probably damaging Het
Hmgxb3 C T 18: 61,155,023 probably benign Het
Ifit2 T C 19: 34,573,350 W97R probably damaging Het
Ift81 T G 5: 122,567,347 K491Q probably benign Het
Ints8 A G 4: 11,230,377 V488A probably benign Het
Krba1 T A 6: 48,414,568 L797Q probably damaging Het
Krr1 T C 10: 111,976,785 V100A probably damaging Het
Nav1 C T 1: 135,607,420 probably benign Het
Nos1 C A 5: 117,943,245 Q1205K probably damaging Het
Nup85 A T 11: 115,568,691 D125V possibly damaging Het
Pclo T G 5: 14,682,148 S3555A probably benign Het
Pdzrn3 T C 6: 101,154,295 I473V probably benign Het
Polr1a A G 6: 71,950,809 E848G possibly damaging Het
Pop1 T C 15: 34,508,598 probably benign Het
Prpf3 C T 3: 95,848,989 E117K probably benign Het
Psmg3 C T 5: 139,823,989 V101M probably benign Het
Rexo1 G A 10: 80,561,266 S52L probably benign Het
Ryk C T 9: 102,875,772 T210M probably damaging Het
Sde2 A G 1: 180,862,633 E306G probably damaging Het
Sec24c A G 14: 20,691,279 Q658R probably benign Het
Sgsm1 G A 5: 113,285,400 T183I probably damaging Het
Skint7 T A 4: 111,980,178 V51E probably damaging Het
Slc6a5 T A 7: 49,948,254 M622K probably benign Het
Slco1a5 T C 6: 142,234,711 H655R probably benign Het
Slco1c1 T A 6: 141,559,852 Y452* probably null Het
Spn T C 7: 127,137,038 E99G probably benign Het
Ssc5d A G 7: 4,937,012 I789V probably benign Het
Taok2 G A 7: 126,870,191 T1155I probably benign Het
Tet2 T C 3: 133,487,767 Q302R possibly damaging Het
Trmt1l A G 1: 151,440,854 T189A probably damaging Het
Tubal3 T C 13: 3,928,192 I36T possibly damaging Het
Vmn2r71 A T 7: 85,618,737 Y133F probably benign Het
Vps11 G T 9: 44,353,261 H673N probably benign Het
Zc3h12a C T 4: 125,120,009 S354N probably benign Het
Zfp2 A G 11: 50,900,962 S85P probably benign Het
Other mutations in Olfr993
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Olfr993 APN 2 85414193 missense probably benign 0.05
IGL03209:Olfr993 APN 2 85414379 missense probably benign 0.05
R0591:Olfr993 UTSW 2 85414690 missense possibly damaging 0.95
R1437:Olfr993 UTSW 2 85414874 missense probably benign 0.01
R1836:Olfr993 UTSW 2 85414405 missense probably benign 0.36
R2902:Olfr993 UTSW 2 85414052 missense possibly damaging 0.79
R2910:Olfr993 UTSW 2 85414351 missense probably damaging 1.00
R3961:Olfr993 UTSW 2 85414872 missense possibly damaging 0.69
R4542:Olfr993 UTSW 2 85413943 missense probably benign
R4635:Olfr993 UTSW 2 85414864 missense probably damaging 1.00
R5464:Olfr993 UTSW 2 85414713 frame shift probably null
R5980:Olfr993 UTSW 2 85414165 missense probably damaging 1.00
R6139:Olfr993 UTSW 2 85414346 missense probably damaging 1.00
R6356:Olfr993 UTSW 2 85414687 missense probably damaging 1.00
R6619:Olfr993 UTSW 2 85414081 missense probably benign 0.05
R6672:Olfr993 UTSW 2 85414604 missense possibly damaging 0.87
R7326:Olfr993 UTSW 2 85414444 missense probably damaging 0.99
R7328:Olfr993 UTSW 2 85414324 missense probably benign 0.32
R7569:Olfr993 UTSW 2 85414135 missense probably damaging 1.00
Z1176:Olfr993 UTSW 2 85414663 missense probably damaging 1.00
Z1176:Olfr993 UTSW 2 85414685 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TAGGAGCCAGCTACCATCTG -3'
(R):5'- CTGGGATTTGGAGTCCAACATG -3'

Sequencing Primer
(F):5'- GCTACCATCTGGATGCAGAC -3'
(R):5'- GGAGTCCAACATGATATTCAGTG -3'
Posted On2014-09-18