Mutagenetix > Incidental Mutations

Incidental Mutation 'R2084:Tet2'

230184

Institutional Source

Beutler Lab

Gene Symbol

Tet2

Ensembl Gene

ENSMUSG00000040943

Gene Name

tet methylcytosine dioxygenase 2

Synonyms

E130014J05Rik, Ayu17-449

MMRRC Submission

040089-MU

Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2084 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133463679-133545139 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 133487767 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 302 (Q302R)

Ref Sequence

ENSEMBL: ENSMUSP00000096203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098603
AA Change: Q302R

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: Q302R

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1203	1819	7e-301	SMART
low complexity region	1832	1844	N/A	INTRINSIC
low complexity region	1885	1897	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196398
AA Change: Q302R

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: Q302R

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1211	1827	3.4e-305	SMART
low complexity region	1840	1852	N/A	INTRINSIC
low complexity region	1893	1905	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197118

Meta Mutation Damage Score

0.0748

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (53/53)

MGI Phenotype

Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]

Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	C	14: 8,558,171	D138G	probably damaging	Het
9530053A07Rik	G	A	7: 28,157,535	V2103M	probably damaging	Het
Ankrd36	C	T	11: 5,662,378	Q1237*	probably null	Het
Aph1c	T	G	9: 66,819,297	R258S	probably damaging	Het
Arfgap3	T	A	15: 83,334,566	N102I	probably damaging	Het
Astn1	T	C	1: 158,472,408	V106A	probably damaging	Het
BC005537	G	T	13: 24,812,715		probably null	Het
Card10	G	A	15: 78,792,971	T412M	possibly damaging	Het
Cars	T	C	7: 143,587,182	I126M	probably benign	Het
Col11a1	C	T	3: 114,158,142	R1074C	probably damaging	Het
Cpped1	T	C	16: 11,828,501	D153G	probably damaging	Het
Cyp2j11	T	A	4: 96,339,201	I193F	probably damaging	Het
Dnm2	T	C	9: 21,500,371		probably null	Het
Efemp1	A	G	11: 28,915,763	D288G	probably damaging	Het
Espl1	T	C	15: 102,296,851		probably null	Het
Fcrl5	T	C	3: 87,444,230	F262L	probably benign	Het
Gh	G	A	11: 106,301,132	P84L	probably damaging	Het
Gm10267	T	C	18: 44,157,330	R37G	probably benign	Het
Gm13089	T	A	4: 143,699,350	T8S	probably damaging	Het
Hmgxb3	C	T	18: 61,155,023		probably benign	Het
Ifit2	T	C	19: 34,573,350	W97R	probably damaging	Het
Ift81	T	G	5: 122,567,347	K491Q	probably benign	Het
Ints8	A	G	4: 11,230,377	V488A	probably benign	Het
Krba1	T	A	6: 48,414,568	L797Q	probably damaging	Het
Krr1	T	C	10: 111,976,785	V100A	probably damaging	Het
Nav1	C	T	1: 135,607,420		probably benign	Het
Nos1	C	A	5: 117,943,245	Q1205K	probably damaging	Het
Nup85	A	T	11: 115,568,691	D125V	possibly damaging	Het
Olfr993	T	C	2: 85,414,615	E88G	probably benign	Het
Pclo	T	G	5: 14,682,148	S3555A	probably benign	Het
Pdzrn3	T	C	6: 101,154,295	I473V	probably benign	Het
Polr1a	A	G	6: 71,950,809	E848G	possibly damaging	Het
Pop1	T	C	15: 34,508,598		probably benign	Het
Prpf3	C	T	3: 95,848,989	E117K	probably benign	Het
Psmg3	C	T	5: 139,823,989	V101M	probably benign	Het
Rexo1	G	A	10: 80,561,266	S52L	probably benign	Het
Ryk	C	T	9: 102,875,772	T210M	probably damaging	Het
Sde2	A	G	1: 180,862,633	E306G	probably damaging	Het
Sec24c	A	G	14: 20,691,279	Q658R	probably benign	Het
Sgsm1	G	A	5: 113,285,400	T183I	probably damaging	Het
Skint7	T	A	4: 111,980,178	V51E	probably damaging	Het
Slc6a5	T	A	7: 49,948,254	M622K	probably benign	Het
Slco1a5	T	C	6: 142,234,711	H655R	probably benign	Het
Slco1c1	T	A	6: 141,559,852	Y452*	probably null	Het
Spn	T	C	7: 127,137,038	E99G	probably benign	Het
Ssc5d	A	G	7: 4,937,012	I789V	probably benign	Het
Taok2	G	A	7: 126,870,191	T1155I	probably benign	Het
Trmt1l	A	G	1: 151,440,854	T189A	probably damaging	Het
Tubal3	T	C	13: 3,928,192	I36T	possibly damaging	Het
Vmn2r71	A	T	7: 85,618,737	Y133F	probably benign	Het
Vps11	G	T	9: 44,353,261	H673N	probably benign	Het
Zc3h12a	C	T	4: 125,120,009	S354N	probably benign	Het
Zfp2	A	G	11: 50,900,962	S85P	probably benign	Het

Other mutations in Tet2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Tet2	APN	3	133488085	missense	possibly damaging	0.96
IGL00401:Tet2	APN	3	133466882	missense	possibly damaging	0.72
IGL01528:Tet2	APN	3	133480298	missense	possibly damaging	0.86
IGL02053:Tet2	APN	3	133488523	missense	possibly damaging	0.96
IGL02142:Tet2	APN	3	133480139	missense	possibly damaging	0.96
IGL02512:Tet2	APN	3	133469308	missense	probably benign	0.05
IGL03148:Tet2	APN	3	133481363	missense	probably benign	0.18
IGL03182:Tet2	APN	3	133471398	nonsense	probably null
IGL03371:Tet2	APN	3	133467551	missense	possibly damaging	0.71
P0022:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0023:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0031:Tet2	UTSW	3	133480202	missense	possibly damaging	0.53
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0463:Tet2	UTSW	3	133486666	missense	possibly damaging	0.86
R0522:Tet2	UTSW	3	133466804	missense	probably damaging	0.98
R0593:Tet2	UTSW	3	133488109	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467602	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467725	missense	probably benign	0.01
R0698:Tet2	UTSW	3	133467384	missense	probably benign	0.32
R0723:Tet2	UTSW	3	133467284	missense	probably benign
R0726:Tet2	UTSW	3	133468184	missense	probably benign
R0747:Tet2	UTSW	3	133467470	missense	possibly damaging	0.86
R1006:Tet2	UTSW	3	133476601	missense	possibly damaging	0.53
R1382:Tet2	UTSW	3	133476615	missense	probably damaging	1.00
R1455:Tet2	UTSW	3	133473645	missense	possibly damaging	0.51
R1550:Tet2	UTSW	3	133469519	missense	probably benign	0.32
R1647:Tet2	UTSW	3	133485880	missense	probably benign
R1662:Tet2	UTSW	3	133466852	missense	possibly damaging	0.96
R1727:Tet2	UTSW	3	133487290	missense	probably damaging	0.98
R1738:Tet2	UTSW	3	133481387	missense	probably benign	0.08
R1749:Tet2	UTSW	3	133480131	critical splice donor site	probably null
R1869:Tet2	UTSW	3	133481441	splice site	probably null
R1887:Tet2	UTSW	3	133487333	missense	possibly damaging	0.68
R1937:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1939:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1940:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1997:Tet2	UTSW	3	133486589	nonsense	probably null
R2082:Tet2	UTSW	3	133485727	missense	possibly damaging	0.96
R2215:Tet2	UTSW	3	133486601	missense	probably benign	0.03
R2321:Tet2	UTSW	3	133486339	missense	possibly damaging	0.53
R2873:Tet2	UTSW	3	133486954	missense	probably damaging	1.00
R3439:Tet2	UTSW	3	133466831	missense	possibly damaging	0.93
R3783:Tet2	UTSW	3	133479363	missense	possibly damaging	0.53
R3894:Tet2	UTSW	3	133469477	missense	possibly damaging	0.86
R3916:Tet2	UTSW	3	133486055	missense	possibly damaging	0.53
R3966:Tet2	UTSW	3	133487657	missense	possibly damaging	0.73
R4457:Tet2	UTSW	3	133485563	missense	possibly damaging	0.85
R4633:Tet2	UTSW	3	133485549	missense	probably benign	0.33
R4646:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4647:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4648:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4691:Tet2	UTSW	3	133486083	missense	possibly damaging	0.73
R4805:Tet2	UTSW	3	133467315	missense	probably benign	0.32
R4829:Tet2	UTSW	3	133476620	missense	possibly damaging	0.91
R4901:Tet2	UTSW	3	133467044	missense	possibly damaging	0.86
R4975:Tet2	UTSW	3	133486759	unclassified	probably benign
R5004:Tet2	UTSW	3	133487379	missense	possibly damaging	0.84
R5075:Tet2	UTSW	3	133486906	missense	probably benign
R5137:Tet2	UTSW	3	133476565	missense	probably benign	0.32
R5324:Tet2	UTSW	3	133485913	missense	probably benign	0.00
R5590:Tet2	UTSW	3	133476480	splice site	probably null
R5854:Tet2	UTSW	3	133487885	missense	probably damaging	0.98
R5856:Tet2	UTSW	3	133486640	missense	probably benign	0.01
R5865:Tet2	UTSW	3	133487099	missense	probably benign	0.08
R5879:Tet2	UTSW	3	133487960	missense	possibly damaging	0.96
R5935:Tet2	UTSW	3	133488535	missense	possibly damaging	0.68
R6012:Tet2	UTSW	3	133466781	missense	possibly damaging	0.86
R6075:Tet2	UTSW	3	133471435	missense	possibly damaging	0.71
R6181:Tet2	UTSW	3	133487759	nonsense	probably null
R6188:Tet2	UTSW	3	133480326	missense	probably benign	0.18
R6339:Tet2	UTSW	3	133486417	missense	possibly damaging	0.53
R6612:Tet2	UTSW	3	133487335	missense	possibly damaging	0.53
R6923:Tet2	UTSW	3	133479341	critical splice donor site	probably null
R6934:Tet2	UTSW	3	133483237	critical splice donor site	probably null
R7076:Tet2	UTSW	3	133467023	missense	possibly damaging	0.71
R7155:Tet2	UTSW	3	133469591	missense	possibly damaging	0.71
R7184:Tet2	UTSW	3	133473630	missense	probably damaging	0.98
R7200:Tet2	UTSW	3	133487192	missense	probably benign	0.18
R7459:Tet2	UTSW	3	133480289	missense	possibly damaging	0.53
R7504:Tet2	UTSW	3	133487339	missense	probably benign	0.33
R7524:Tet2	UTSW	3	133480229	missense	probably benign	0.33
R7613:Tet2	UTSW	3	133466748	missense	possibly damaging	0.83
R7653:Tet2	UTSW	3	133486385	missense	probably benign	0.18
R7691:Tet2	UTSW	3	133486849	missense	probably damaging	0.98
R7770:Tet2	UTSW	3	133480295	missense	possibly damaging	0.53
R7807:Tet2	UTSW	3	133486541	missense	possibly damaging	0.53
R7813:Tet2	UTSW	3	133473643	missense	probably benign	0.06
R7978:Tet2	UTSW	3	133487665	missense	possibly damaging	0.96
R8055:Tet2	UTSW	3	133467992	missense	possibly damaging	0.93
R8164:Tet2	UTSW	3	133467134	missense	possibly damaging	0.85
R8236:Tet2	UTSW	3	133487786	missense	probably benign	0.00
X0021:Tet2	UTSW	3	133486295	missense	possibly damaging	0.85
X0066:Tet2	UTSW	3	133488373	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GCCTGAAGTAAGCACCATTG -3'
(R):5'- GCAGAGTACCGCATCTCATG -3'

Sequencing Primer
(F):5'- GCCTGAAGTAAGCACCATTGGTTTC -3'
(R):5'- CAGTCAGGCTGCTATCGAG -3'

Posted On

2014-09-18