Mutagenetix > Incidental Mutations

Incidental Mutation 'R2084:Pdzrn3'

230197

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn3

Ensembl Gene

ENSMUSG00000035357

Gene Name

PDZ domain containing RING finger 3

Synonyms

LNX3, semaphorin cytoplasmic domain-associated protein 3A, Semcap3, 1110020C07Rik

MMRRC Submission

040089-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.769) question?

Stock #

R2084 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

101149609-101377897 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101154295 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 473 (I473V)

Ref Sequence

ENSEMBL: ENSMUSP00000075376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075994]

Predicted Effect

probably benign
Transcript: ENSMUST00000075994
AA Change: I473V

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000075376
Gene: ENSMUSG00000035357
AA Change: I473V

Domain	Start	End	E-Value	Type
RING	18	55	3.93e-3	SMART
low complexity region	198	214	N/A	INTRINSIC
PDZ	257	339	3.38e-21	SMART
PDZ	429	504	3.86e-16	SMART
low complexity region	512	526	N/A	INTRINSIC
low complexity region	660	671	N/A	INTRINSIC
low complexity region	1020	1029	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124884

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203474

Meta Mutation Damage Score

0.1944

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LNX (Ligand of Numb Protein-X) family of RING-type ubiquitin E3 ligases. This protein may function in vascular morphogenesis and the differentiation of adipocytes, osteoblasts and myoblasts. This protein may be targeted for degradation by the human papilloma virus E6 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	C	14: 8,558,171	D138G	probably damaging	Het
9530053A07Rik	G	A	7: 28,157,535	V2103M	probably damaging	Het
Ankrd36	C	T	11: 5,662,378	Q1237*	probably null	Het
Aph1c	T	G	9: 66,819,297	R258S	probably damaging	Het
Arfgap3	T	A	15: 83,334,566	N102I	probably damaging	Het
Astn1	T	C	1: 158,472,408	V106A	probably damaging	Het
BC005537	G	T	13: 24,812,715		probably null	Het
Card10	G	A	15: 78,792,971	T412M	possibly damaging	Het
Cars	T	C	7: 143,587,182	I126M	probably benign	Het
Col11a1	C	T	3: 114,158,142	R1074C	probably damaging	Het
Cpped1	T	C	16: 11,828,501	D153G	probably damaging	Het
Cyp2j11	T	A	4: 96,339,201	I193F	probably damaging	Het
Dnm2	T	C	9: 21,500,371		probably null	Het
Efemp1	A	G	11: 28,915,763	D288G	probably damaging	Het
Espl1	T	C	15: 102,296,851		probably null	Het
Fcrl5	T	C	3: 87,444,230	F262L	probably benign	Het
Gh	G	A	11: 106,301,132	P84L	probably damaging	Het
Gm10267	T	C	18: 44,157,330	R37G	probably benign	Het
Gm13089	T	A	4: 143,699,350	T8S	probably damaging	Het
Hmgxb3	C	T	18: 61,155,023		probably benign	Het
Ifit2	T	C	19: 34,573,350	W97R	probably damaging	Het
Ift81	T	G	5: 122,567,347	K491Q	probably benign	Het
Ints8	A	G	4: 11,230,377	V488A	probably benign	Het
Krba1	T	A	6: 48,414,568	L797Q	probably damaging	Het
Krr1	T	C	10: 111,976,785	V100A	probably damaging	Het
Nav1	C	T	1: 135,607,420		probably benign	Het
Nos1	C	A	5: 117,943,245	Q1205K	probably damaging	Het
Nup85	A	T	11: 115,568,691	D125V	possibly damaging	Het
Olfr993	T	C	2: 85,414,615	E88G	probably benign	Het
Pclo	T	G	5: 14,682,148	S3555A	probably benign	Het
Polr1a	A	G	6: 71,950,809	E848G	possibly damaging	Het
Pop1	T	C	15: 34,508,598		probably benign	Het
Prpf3	C	T	3: 95,848,989	E117K	probably benign	Het
Psmg3	C	T	5: 139,823,989	V101M	probably benign	Het
Rexo1	G	A	10: 80,561,266	S52L	probably benign	Het
Ryk	C	T	9: 102,875,772	T210M	probably damaging	Het
Sde2	A	G	1: 180,862,633	E306G	probably damaging	Het
Sec24c	A	G	14: 20,691,279	Q658R	probably benign	Het
Sgsm1	G	A	5: 113,285,400	T183I	probably damaging	Het
Skint7	T	A	4: 111,980,178	V51E	probably damaging	Het
Slc6a5	T	A	7: 49,948,254	M622K	probably benign	Het
Slco1a5	T	C	6: 142,234,711	H655R	probably benign	Het
Slco1c1	T	A	6: 141,559,852	Y452*	probably null	Het
Spn	T	C	7: 127,137,038	E99G	probably benign	Het
Ssc5d	A	G	7: 4,937,012	I789V	probably benign	Het
Taok2	G	A	7: 126,870,191	T1155I	probably benign	Het
Tet2	T	C	3: 133,487,767	Q302R	possibly damaging	Het
Trmt1l	A	G	1: 151,440,854	T189A	probably damaging	Het
Tubal3	T	C	13: 3,928,192	I36T	possibly damaging	Het
Vmn2r71	A	T	7: 85,618,737	Y133F	probably benign	Het
Vps11	G	T	9: 44,353,261	H673N	probably benign	Het
Zc3h12a	C	T	4: 125,120,009	S354N	probably benign	Het
Zfp2	A	G	11: 50,900,962	S85P	probably benign	Het

Other mutations in Pdzrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Pdzrn3	APN	6	101354486	missense	probably benign	0.01
IGL01511:Pdzrn3	APN	6	101153256	missense	possibly damaging	0.66
IGL01554:Pdzrn3	APN	6	101150541	missense	probably damaging	1.00
IGL02450:Pdzrn3	APN	6	101354500	missense	probably damaging	1.00
IGL02505:Pdzrn3	APN	6	101151938	missense	possibly damaging	0.94
IGL03061:Pdzrn3	APN	6	101151855	missense	probably damaging	1.00
IGL03210:Pdzrn3	APN	6	101156952	missense	possibly damaging	0.95
gefilte	UTSW	6	101154192	critical splice donor site	probably null
implevit_bonis	UTSW	6	101151022	missense	probably benign	0.15
predisposition	UTSW	6	101151053	missense	probably damaging	1.00
tendency	UTSW	6	101151428	missense	probably damaging	1.00
PIT4581001:Pdzrn3	UTSW	6	101151503	missense	probably benign	0.00
R0110:Pdzrn3	UTSW	6	101151053	missense	probably damaging	1.00
R0469:Pdzrn3	UTSW	6	101151053	missense	probably damaging	1.00
R0496:Pdzrn3	UTSW	6	101150570	missense	possibly damaging	0.94
R0510:Pdzrn3	UTSW	6	101151053	missense	probably damaging	1.00
R0883:Pdzrn3	UTSW	6	101155942	splice site	probably null
R1171:Pdzrn3	UTSW	6	101150877	missense	probably damaging	1.00
R1471:Pdzrn3	UTSW	6	101151512	missense	possibly damaging	0.77
R1496:Pdzrn3	UTSW	6	101150969	missense	probably benign	0.00
R1596:Pdzrn3	UTSW	6	101151005	missense	probably benign	0.03
R2033:Pdzrn3	UTSW	6	101150954	missense	probably damaging	1.00
R2068:Pdzrn3	UTSW	6	101150699	missense	probably damaging	1.00
R2432:Pdzrn3	UTSW	6	101150791	missense	probably damaging	1.00
R3727:Pdzrn3	UTSW	6	101156945	missense	probably damaging	0.98
R3861:Pdzrn3	UTSW	6	101172371	missense	possibly damaging	0.95
R4616:Pdzrn3	UTSW	6	101152009	missense	probably damaging	0.99
R4967:Pdzrn3	UTSW	6	101151590	missense	probably damaging	1.00
R5224:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5226:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5227:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5230:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5320:Pdzrn3	UTSW	6	101151103	missense	probably damaging	1.00
R5414:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5686:Pdzrn3	UTSW	6	101151428	missense	probably damaging	1.00
R5772:Pdzrn3	UTSW	6	101172314	missense	probably benign	0.00
R6026:Pdzrn3	UTSW	6	101362144	missense	probably benign	0.40
R6213:Pdzrn3	UTSW	6	101377844	missense	probably damaging	1.00
R6518:Pdzrn3	UTSW	6	101150514	makesense	probably null
R6657:Pdzrn3	UTSW	6	101151022	missense	probably benign	0.15
R6951:Pdzrn3	UTSW	6	101154192	critical splice donor site	probably null
R7055:Pdzrn3	UTSW	6	101151774	nonsense	probably null
R7290:Pdzrn3	UTSW	6	101151245	missense	probably benign
R7608:Pdzrn3	UTSW	6	101151752	missense	probably damaging	1.00
R7834:Pdzrn3	UTSW	6	101151195	missense	probably damaging	0.97
R7917:Pdzrn3	UTSW	6	101151195	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCGAGTTCAAGGTGGCATGC -3'
(R):5'- AGGCCTTTCTTTCCAGAAACCAG -3'

Sequencing Primer
(F):5'- CTCAGATGGCAAGACTCTGACATTG -3'
(R):5'- CCAGCATTCTTTAAAAGCTAAATGGG -3'

Posted On

2014-09-18