Incidental Mutation 'R2084:Ssc5d'
ID230200
Institutional Source Beutler Lab
Gene Symbol Ssc5d
Ensembl Gene ENSMUSG00000035279
Gene Namescavenger receptor cysteine rich family, 5 domains
Synonymss5d-srcrb, A430110N23Rik
MMRRC Submission 040089-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2084 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4925785-4944826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4937012 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 789 (I789V)
Ref Sequence ENSEMBL: ENSMUSP00000052126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]
Predicted Effect probably benign
Transcript: ENSMUST00000057612
AA Change: I789V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: I789V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SR 20 120 4.44e-49 SMART
low complexity region 141 155 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
SR 199 299 2.36e-53 SMART
SR 305 405 8.22e-53 SMART
low complexity region 437 462 N/A INTRINSIC
SR 464 565 1.11e-49 SMART
low complexity region 741 755 N/A INTRINSIC
SR 758 858 3.93e-50 SMART
low complexity region 936 957 N/A INTRINSIC
low complexity region 981 1004 N/A INTRINSIC
low complexity region 1018 1035 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1357 1364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207310
Predicted Effect probably benign
Transcript: ENSMUST00000208109
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T C 14: 8,558,171 D138G probably damaging Het
9530053A07Rik G A 7: 28,157,535 V2103M probably damaging Het
Ankrd36 C T 11: 5,662,378 Q1237* probably null Het
Aph1c T G 9: 66,819,297 R258S probably damaging Het
Arfgap3 T A 15: 83,334,566 N102I probably damaging Het
Astn1 T C 1: 158,472,408 V106A probably damaging Het
BC005537 G T 13: 24,812,715 probably null Het
Card10 G A 15: 78,792,971 T412M possibly damaging Het
Cars T C 7: 143,587,182 I126M probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Cpped1 T C 16: 11,828,501 D153G probably damaging Het
Cyp2j11 T A 4: 96,339,201 I193F probably damaging Het
Dnm2 T C 9: 21,500,371 probably null Het
Efemp1 A G 11: 28,915,763 D288G probably damaging Het
Espl1 T C 15: 102,296,851 probably null Het
Fcrl5 T C 3: 87,444,230 F262L probably benign Het
Gh G A 11: 106,301,132 P84L probably damaging Het
Gm10267 T C 18: 44,157,330 R37G probably benign Het
Gm13089 T A 4: 143,699,350 T8S probably damaging Het
Hmgxb3 C T 18: 61,155,023 probably benign Het
Ifit2 T C 19: 34,573,350 W97R probably damaging Het
Ift81 T G 5: 122,567,347 K491Q probably benign Het
Ints8 A G 4: 11,230,377 V488A probably benign Het
Krba1 T A 6: 48,414,568 L797Q probably damaging Het
Krr1 T C 10: 111,976,785 V100A probably damaging Het
Nav1 C T 1: 135,607,420 probably benign Het
Nos1 C A 5: 117,943,245 Q1205K probably damaging Het
Nup85 A T 11: 115,568,691 D125V possibly damaging Het
Olfr993 T C 2: 85,414,615 E88G probably benign Het
Pclo T G 5: 14,682,148 S3555A probably benign Het
Pdzrn3 T C 6: 101,154,295 I473V probably benign Het
Polr1a A G 6: 71,950,809 E848G possibly damaging Het
Pop1 T C 15: 34,508,598 probably benign Het
Prpf3 C T 3: 95,848,989 E117K probably benign Het
Psmg3 C T 5: 139,823,989 V101M probably benign Het
Rexo1 G A 10: 80,561,266 S52L probably benign Het
Ryk C T 9: 102,875,772 T210M probably damaging Het
Sde2 A G 1: 180,862,633 E306G probably damaging Het
Sec24c A G 14: 20,691,279 Q658R probably benign Het
Sgsm1 G A 5: 113,285,400 T183I probably damaging Het
Skint7 T A 4: 111,980,178 V51E probably damaging Het
Slc6a5 T A 7: 49,948,254 M622K probably benign Het
Slco1a5 T C 6: 142,234,711 H655R probably benign Het
Slco1c1 T A 6: 141,559,852 Y452* probably null Het
Spn T C 7: 127,137,038 E99G probably benign Het
Taok2 G A 7: 126,870,191 T1155I probably benign Het
Tet2 T C 3: 133,487,767 Q302R possibly damaging Het
Trmt1l A G 1: 151,440,854 T189A probably damaging Het
Tubal3 T C 13: 3,928,192 I36T possibly damaging Het
Vmn2r71 A T 7: 85,618,737 Y133F probably benign Het
Vps11 G T 9: 44,353,261 H673N probably benign Het
Zc3h12a C T 4: 125,120,009 S354N probably benign Het
Zfp2 A G 11: 50,900,962 S85P probably benign Het
Other mutations in Ssc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ssc5d APN 7 4944481 missense possibly damaging 0.63
IGL00939:Ssc5d APN 7 4936281 missense possibly damaging 0.89
IGL01109:Ssc5d APN 7 4937112 nonsense probably null
IGL01409:Ssc5d APN 7 4942809 missense probably benign 0.16
IGL01880:Ssc5d APN 7 4933219 missense probably damaging 1.00
IGL02013:Ssc5d APN 7 4943836 missense probably benign 0.00
IGL02227:Ssc5d APN 7 4933454 critical splice donor site probably null
IGL02963:Ssc5d APN 7 4944327 missense probably benign 0.02
D4043:Ssc5d UTSW 7 4943983 missense possibly damaging 0.70
D4216:Ssc5d UTSW 7 4943983 missense possibly damaging 0.70
R0104:Ssc5d UTSW 7 4936286 missense probably benign 0.41
R0115:Ssc5d UTSW 7 4927881 unclassified probably benign
R0201:Ssc5d UTSW 7 4944663 missense probably benign
R0365:Ssc5d UTSW 7 4928467 nonsense probably null
R0485:Ssc5d UTSW 7 4937471 missense probably damaging 0.99
R0967:Ssc5d UTSW 7 4944343 nonsense probably null
R1607:Ssc5d UTSW 7 4944043 missense probably benign 0.25
R1639:Ssc5d UTSW 7 4928417 missense probably damaging 1.00
R1801:Ssc5d UTSW 7 4936607 missense probably benign 0.05
R1867:Ssc5d UTSW 7 4928507 missense probably damaging 1.00
R1999:Ssc5d UTSW 7 4942714 missense possibly damaging 0.86
R2007:Ssc5d UTSW 7 4928629 missense probably damaging 1.00
R2234:Ssc5d UTSW 7 4943850 missense probably benign
R2259:Ssc5d UTSW 7 4943916 missense probably benign 0.01
R2567:Ssc5d UTSW 7 4936335 missense probably damaging 1.00
R2879:Ssc5d UTSW 7 4936907 critical splice acceptor site probably null
R3782:Ssc5d UTSW 7 4942791 missense probably benign 0.00
R3875:Ssc5d UTSW 7 4927262 missense probably damaging 1.00
R4322:Ssc5d UTSW 7 4928450 missense probably damaging 1.00
R4331:Ssc5d UTSW 7 4942726 missense probably benign 0.00
R4334:Ssc5d UTSW 7 4943664 missense probably benign
R4430:Ssc5d UTSW 7 4943664 missense probably benign
R4619:Ssc5d UTSW 7 4929525 missense probably damaging 1.00
R4794:Ssc5d UTSW 7 4943745 missense probably benign
R5106:Ssc5d UTSW 7 4936665 missense probably benign 0.31
R5174:Ssc5d UTSW 7 4927971 missense possibly damaging 0.83
R5553:Ssc5d UTSW 7 4936290 missense probably damaging 1.00
R5649:Ssc5d UTSW 7 4926518 critical splice donor site probably null
R5786:Ssc5d UTSW 7 4936818 missense probably benign 0.00
R6059:Ssc5d UTSW 7 4942744 missense possibly damaging 0.86
R6163:Ssc5d UTSW 7 4927254 missense probably damaging 1.00
R6332:Ssc5d UTSW 7 4937522 missense probably damaging 1.00
R6341:Ssc5d UTSW 7 4936665 missense probably benign 0.31
R6613:Ssc5d UTSW 7 4933293 missense possibly damaging 0.82
R7180:Ssc5d UTSW 7 4936601 missense probably benign 0.17
R7576:Ssc5d UTSW 7 4928573 missense probably damaging 1.00
R7602:Ssc5d UTSW 7 4942746 missense possibly damaging 0.95
R7609:Ssc5d UTSW 7 4927576 missense possibly damaging 0.56
R7691:Ssc5d UTSW 7 4944169 missense probably benign 0.29
R7759:Ssc5d UTSW 7 4937530 nonsense probably null
R8480:Ssc5d UTSW 7 4936329 missense probably damaging 1.00
X0063:Ssc5d UTSW 7 4936287 missense probably damaging 1.00
Z1088:Ssc5d UTSW 7 4928434 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGCCATCAGGTGAGTAGTAG -3'
(R):5'- GTGAGCACCACGTCTTCTTC -3'

Sequencing Primer
(F):5'- TCAGGTGAGTAGTAGAGAGTTAAAAG -3'
(R):5'- ACGTCTTCTTCGTGGTCACAG -3'
Posted On2014-09-18