Mutagenetix > Incidental Mutation

Incidental Mutation 'R2084:Ssc5d'

230200

Institutional Source

Beutler Lab

Gene Symbol

Ssc5d

Ensembl Gene

ENSMUSG00000035279

Gene Name

scavenger receptor cysteine rich family, 5 domains

Synonyms

s5d-srcrb, A430110N23Rik

MMRRC Submission

040089-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2084 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4925785-4944826 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4937012 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 789 (I789V)

Ref Sequence

ENSEMBL: ENSMUSP00000052126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]

AlphaFold

Q8BV57

Predicted Effect

probably benign
Transcript: ENSMUST00000057612
AA Change: I789V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: I789V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SR	20	120	4.44e-49	SMART
low complexity region	141	155	N/A	INTRINSIC
low complexity region	167	182	N/A	INTRINSIC
SR	199	299	2.36e-53	SMART
SR	305	405	8.22e-53	SMART
low complexity region	437	462	N/A	INTRINSIC
SR	464	565	1.11e-49	SMART
low complexity region	741	755	N/A	INTRINSIC
SR	758	858	3.93e-50	SMART
low complexity region	936	957	N/A	INTRINSIC
low complexity region	981	1004	N/A	INTRINSIC
low complexity region	1018	1035	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1357	1364	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207310

Predicted Effect

probably benign
Transcript: ENSMUST00000208109

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	C	14: 8,558,171	D138G	probably damaging	Het
9530053A07Rik	G	A	7: 28,157,535	V2103M	probably damaging	Het
Ankrd36	C	T	11: 5,662,378	Q1237*	probably null	Het
Aph1c	T	G	9: 66,819,297	R258S	probably damaging	Het
Arfgap3	T	A	15: 83,334,566	N102I	probably damaging	Het
Astn1	T	C	1: 158,472,408	V106A	probably damaging	Het
BC005537	G	T	13: 24,812,715		probably null	Het
Card10	G	A	15: 78,792,971	T412M	possibly damaging	Het
Cars	T	C	7: 143,587,182	I126M	probably benign	Het
Col11a1	C	T	3: 114,158,142	R1074C	probably damaging	Het
Cpped1	T	C	16: 11,828,501	D153G	probably damaging	Het
Cyp2j11	T	A	4: 96,339,201	I193F	probably damaging	Het
Dnm2	T	C	9: 21,500,371		probably null	Het
Efemp1	A	G	11: 28,915,763	D288G	probably damaging	Het
Espl1	T	C	15: 102,296,851		probably null	Het
Fcrl5	T	C	3: 87,444,230	F262L	probably benign	Het
Gh	G	A	11: 106,301,132	P84L	probably damaging	Het
Gm10267	T	C	18: 44,157,330	R37G	probably benign	Het
Gm13089	T	A	4: 143,699,350	T8S	probably damaging	Het
Hmgxb3	C	T	18: 61,155,023		probably benign	Het
Ifit2	T	C	19: 34,573,350	W97R	probably damaging	Het
Ift81	T	G	5: 122,567,347	K491Q	probably benign	Het
Ints8	A	G	4: 11,230,377	V488A	probably benign	Het
Krba1	T	A	6: 48,414,568	L797Q	probably damaging	Het
Krr1	T	C	10: 111,976,785	V100A	probably damaging	Het
Nav1	C	T	1: 135,607,420		probably benign	Het
Nos1	C	A	5: 117,943,245	Q1205K	probably damaging	Het
Nup85	A	T	11: 115,568,691	D125V	possibly damaging	Het
Olfr993	T	C	2: 85,414,615	E88G	probably benign	Het
Pclo	T	G	5: 14,682,148	S3555A	probably benign	Het
Pdzrn3	T	C	6: 101,154,295	I473V	probably benign	Het
Polr1a	A	G	6: 71,950,809	E848G	possibly damaging	Het
Pop1	T	C	15: 34,508,598		probably benign	Het
Prpf3	C	T	3: 95,848,989	E117K	probably benign	Het
Psmg3	C	T	5: 139,823,989	V101M	probably benign	Het
Rexo1	G	A	10: 80,561,266	S52L	probably benign	Het
Ryk	C	T	9: 102,875,772	T210M	probably damaging	Het
Sde2	A	G	1: 180,862,633	E306G	probably damaging	Het
Sec24c	A	G	14: 20,691,279	Q658R	probably benign	Het
Sgsm1	G	A	5: 113,285,400	T183I	probably damaging	Het
Skint7	T	A	4: 111,980,178	V51E	probably damaging	Het
Slc6a5	T	A	7: 49,948,254	M622K	probably benign	Het
Slco1a5	T	C	6: 142,234,711	H655R	probably benign	Het
Slco1c1	T	A	6: 141,559,852	Y452*	probably null	Het
Spn	T	C	7: 127,137,038	E99G	probably benign	Het
Taok2	G	A	7: 126,870,191	T1155I	probably benign	Het
Tet2	T	C	3: 133,487,767	Q302R	possibly damaging	Het
Trmt1l	A	G	1: 151,440,854	T189A	probably damaging	Het
Tubal3	T	C	13: 3,928,192	I36T	possibly damaging	Het
Vmn2r71	A	T	7: 85,618,737	Y133F	probably benign	Het
Vps11	G	T	9: 44,353,261	H673N	probably benign	Het
Zc3h12a	C	T	4: 125,120,009	S354N	probably benign	Het
Zfp2	A	G	11: 50,900,962	S85P	probably benign	Het

Other mutations in Ssc5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Ssc5d	APN	7	4944481	missense	possibly damaging	0.63
IGL00939:Ssc5d	APN	7	4936281	missense	possibly damaging	0.89
IGL01109:Ssc5d	APN	7	4937112	nonsense	probably null
IGL01409:Ssc5d	APN	7	4942809	missense	probably benign	0.16
IGL01880:Ssc5d	APN	7	4933219	missense	probably damaging	1.00
IGL02013:Ssc5d	APN	7	4943836	missense	probably benign	0.00
IGL02227:Ssc5d	APN	7	4933454	critical splice donor site	probably null
IGL02963:Ssc5d	APN	7	4944327	missense	probably benign	0.02
D4043:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
D4216:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
R0104:Ssc5d	UTSW	7	4936286	missense	probably benign	0.41
R0115:Ssc5d	UTSW	7	4927881	unclassified	probably benign
R0201:Ssc5d	UTSW	7	4944663	missense	probably benign
R0365:Ssc5d	UTSW	7	4928467	nonsense	probably null
R0485:Ssc5d	UTSW	7	4937471	missense	probably damaging	0.99
R0967:Ssc5d	UTSW	7	4944343	nonsense	probably null
R1607:Ssc5d	UTSW	7	4944043	missense	probably benign	0.25
R1639:Ssc5d	UTSW	7	4928417	missense	probably damaging	1.00
R1801:Ssc5d	UTSW	7	4936607	missense	probably benign	0.05
R1867:Ssc5d	UTSW	7	4928507	missense	probably damaging	1.00
R1999:Ssc5d	UTSW	7	4942714	missense	possibly damaging	0.86
R2007:Ssc5d	UTSW	7	4928629	missense	probably damaging	1.00
R2234:Ssc5d	UTSW	7	4943850	missense	probably benign
R2259:Ssc5d	UTSW	7	4943916	missense	probably benign	0.01
R2567:Ssc5d	UTSW	7	4936335	missense	probably damaging	1.00
R2879:Ssc5d	UTSW	7	4936907	critical splice acceptor site	probably null
R3782:Ssc5d	UTSW	7	4942791	missense	probably benign	0.00
R3875:Ssc5d	UTSW	7	4927262	missense	probably damaging	1.00
R4322:Ssc5d	UTSW	7	4928450	missense	probably damaging	1.00
R4331:Ssc5d	UTSW	7	4942726	missense	probably benign	0.00
R4334:Ssc5d	UTSW	7	4943664	missense	probably benign
R4430:Ssc5d	UTSW	7	4943664	missense	probably benign
R4619:Ssc5d	UTSW	7	4929525	missense	probably damaging	1.00
R4794:Ssc5d	UTSW	7	4943745	missense	probably benign
R5106:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R5174:Ssc5d	UTSW	7	4927971	missense	possibly damaging	0.83
R5553:Ssc5d	UTSW	7	4936290	missense	probably damaging	1.00
R5649:Ssc5d	UTSW	7	4926518	critical splice donor site	probably null
R5786:Ssc5d	UTSW	7	4936818	missense	probably benign	0.00
R6059:Ssc5d	UTSW	7	4942744	missense	possibly damaging	0.86
R6163:Ssc5d	UTSW	7	4927254	missense	probably damaging	1.00
R6332:Ssc5d	UTSW	7	4937522	missense	probably damaging	1.00
R6341:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R6613:Ssc5d	UTSW	7	4933293	missense	possibly damaging	0.82
R7180:Ssc5d	UTSW	7	4936601	missense	probably benign	0.17
R7576:Ssc5d	UTSW	7	4928573	missense	probably damaging	1.00
R7602:Ssc5d	UTSW	7	4942746	missense	possibly damaging	0.95
R7609:Ssc5d	UTSW	7	4927576	missense	possibly damaging	0.56
R7691:Ssc5d	UTSW	7	4944169	missense	probably benign	0.29
R7759:Ssc5d	UTSW	7	4937530	nonsense	probably null
R8480:Ssc5d	UTSW	7	4936329	missense	probably damaging	1.00
R9029:Ssc5d	UTSW	7	4927920	missense	probably damaging	0.97
R9163:Ssc5d	UTSW	7	4933433	missense	probably damaging	1.00
R9178:Ssc5d	UTSW	7	4927059	missense	probably damaging	1.00
R9181:Ssc5d	UTSW	7	4942815	missense	possibly damaging	0.86
R9382:Ssc5d	UTSW	7	4927284	critical splice donor site	probably null
R9489:Ssc5d	UTSW	7	4937600	missense	probably benign	0.02
R9626:Ssc5d	UTSW	7	4943569	missense	probably benign
R9630:Ssc5d	UTSW	7	4936427	missense	probably damaging	1.00
R9776:Ssc5d	UTSW	7	4929368	missense	probably benign	0.07
X0063:Ssc5d	UTSW	7	4936287	missense	probably damaging	1.00
Z1088:Ssc5d	UTSW	7	4928434	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGTGCCATCAGGTGAGTAGTAG -3'
(R):5'- GTGAGCACCACGTCTTCTTC -3'

Sequencing Primer
(F):5'- TCAGGTGAGTAGTAGAGAGTTAAAAG -3'
(R):5'- ACGTCTTCTTCGTGGTCACAG -3'

Posted On

2014-09-18