Incidental Mutation 'R2084:Dnm2'
ID230209
Institutional Source Beutler Lab
Gene Symbol Dnm2
Ensembl Gene ENSMUSG00000033335
Gene Namedynamin 2
Synonymsb2b2159Clo, Dyn2
MMRRC Submission 040089-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2084 (G1)
Quality Score195
Status Not validated
Chromosome9
Chromosomal Location21424908-21507759 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 21500371 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000072362] [ENSMUST00000072362] [ENSMUST00000091087] [ENSMUST00000091087] [ENSMUST00000115404] [ENSMUST00000115404] [ENSMUST00000115404] [ENSMUST00000115404] [ENSMUST00000165766] [ENSMUST00000165766] [ENSMUST00000172482] [ENSMUST00000172482] [ENSMUST00000172482] [ENSMUST00000172482] [ENSMUST00000173397] [ENSMUST00000173397]
Predicted Effect probably null
Transcript: ENSMUST00000072362
SMART Domains Protein: ENSMUSP00000072199
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000072362
SMART Domains Protein: ENSMUSP00000072199
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083613
Predicted Effect probably null
Transcript: ENSMUST00000091087
SMART Domains Protein: ENSMUSP00000088616
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 516 623 8e-13 SMART
GED 644 735 2.57e-28 SMART
low complexity region 736 748 N/A INTRINSIC
low complexity region 773 795 N/A INTRINSIC
low complexity region 827 860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091087
SMART Domains Protein: ENSMUSP00000088616
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 516 623 8e-13 SMART
GED 644 735 2.57e-28 SMART
low complexity region 736 748 N/A INTRINSIC
low complexity region 773 795 N/A INTRINSIC
low complexity region 827 860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115404
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115404
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115404
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115404
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165766
SMART Domains Protein: ENSMUSP00000128961
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 858 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165766
SMART Domains Protein: ENSMUSP00000128961
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 858 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172482
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172482
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172482
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172482
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172763
Predicted Effect probably benign
Transcript: ENSMUST00000172833
SMART Domains Protein: ENSMUSP00000133858
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
Pfam:Dynamin_M 1 163 2.4e-55 PFAM
Pfam:PH 193 248 2.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173299
Predicted Effect probably null
Transcript: ENSMUST00000173397
SMART Domains Protein: ENSMUSP00000134243
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 863 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173397
SMART Domains Protein: ENSMUSP00000134243
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 863 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174050
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174050
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174050
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174050
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174243
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele die prior to E8-E12. Mice heterozygous for a knock-out allele exhibit muscle atrophy and weakness, intermyofibrillar disorganization, and centrally localized mitochondria and sarcoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T C 14: 8,558,171 D138G probably damaging Het
9530053A07Rik G A 7: 28,157,535 V2103M probably damaging Het
Ankrd36 C T 11: 5,662,378 Q1237* probably null Het
Aph1c T G 9: 66,819,297 R258S probably damaging Het
Arfgap3 T A 15: 83,334,566 N102I probably damaging Het
Astn1 T C 1: 158,472,408 V106A probably damaging Het
BC005537 G T 13: 24,812,715 probably null Het
Card10 G A 15: 78,792,971 T412M possibly damaging Het
Cars T C 7: 143,587,182 I126M probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Cpped1 T C 16: 11,828,501 D153G probably damaging Het
Cyp2j11 T A 4: 96,339,201 I193F probably damaging Het
Efemp1 A G 11: 28,915,763 D288G probably damaging Het
Espl1 T C 15: 102,296,851 probably null Het
Fcrl5 T C 3: 87,444,230 F262L probably benign Het
Gh G A 11: 106,301,132 P84L probably damaging Het
Gm10267 T C 18: 44,157,330 R37G probably benign Het
Gm13089 T A 4: 143,699,350 T8S probably damaging Het
Hmgxb3 C T 18: 61,155,023 probably benign Het
Ifit2 T C 19: 34,573,350 W97R probably damaging Het
Ift81 T G 5: 122,567,347 K491Q probably benign Het
Ints8 A G 4: 11,230,377 V488A probably benign Het
Krba1 T A 6: 48,414,568 L797Q probably damaging Het
Krr1 T C 10: 111,976,785 V100A probably damaging Het
Nav1 C T 1: 135,607,420 probably benign Het
Nos1 C A 5: 117,943,245 Q1205K probably damaging Het
Nup85 A T 11: 115,568,691 D125V possibly damaging Het
Olfr993 T C 2: 85,414,615 E88G probably benign Het
Pclo T G 5: 14,682,148 S3555A probably benign Het
Pdzrn3 T C 6: 101,154,295 I473V probably benign Het
Polr1a A G 6: 71,950,809 E848G possibly damaging Het
Pop1 T C 15: 34,508,598 probably benign Het
Prpf3 C T 3: 95,848,989 E117K probably benign Het
Psmg3 C T 5: 139,823,989 V101M probably benign Het
Rexo1 G A 10: 80,561,266 S52L probably benign Het
Ryk C T 9: 102,875,772 T210M probably damaging Het
Sde2 A G 1: 180,862,633 E306G probably damaging Het
Sec24c A G 14: 20,691,279 Q658R probably benign Het
Sgsm1 G A 5: 113,285,400 T183I probably damaging Het
Skint7 T A 4: 111,980,178 V51E probably damaging Het
Slc6a5 T A 7: 49,948,254 M622K probably benign Het
Slco1a5 T C 6: 142,234,711 H655R probably benign Het
Slco1c1 T A 6: 141,559,852 Y452* probably null Het
Spn T C 7: 127,137,038 E99G probably benign Het
Ssc5d A G 7: 4,937,012 I789V probably benign Het
Taok2 G A 7: 126,870,191 T1155I probably benign Het
Tet2 T C 3: 133,487,767 Q302R possibly damaging Het
Trmt1l A G 1: 151,440,854 T189A probably damaging Het
Tubal3 T C 13: 3,928,192 I36T possibly damaging Het
Vmn2r71 A T 7: 85,618,737 Y133F probably benign Het
Vps11 G T 9: 44,353,261 H673N probably benign Het
Zc3h12a C T 4: 125,120,009 S354N probably benign Het
Zfp2 A G 11: 50,900,962 S85P probably benign Het
Other mutations in Dnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Dnm2 APN 9 21481376 missense probably damaging 1.00
IGL01757:Dnm2 APN 9 21465619 missense probably damaging 1.00
IGL02142:Dnm2 APN 9 21500353 missense probably damaging 1.00
IGL02195:Dnm2 APN 9 21425249 missense probably damaging 1.00
IGL02472:Dnm2 APN 9 21485708 missense possibly damaging 0.55
IGL03161:Dnm2 APN 9 21485724 splice site probably benign
IGL03392:Dnm2 APN 9 21474611 missense probably damaging 1.00
R0302:Dnm2 UTSW 9 21500343 missense probably benign 0.27
R0743:Dnm2 UTSW 9 21500265 missense probably damaging 1.00
R0945:Dnm2 UTSW 9 21505660 missense probably damaging 0.97
R1629:Dnm2 UTSW 9 21504458 missense probably damaging 1.00
R1678:Dnm2 UTSW 9 21467532 missense possibly damaging 0.89
R1848:Dnm2 UTSW 9 21505681 missense possibly damaging 0.87
R2214:Dnm2 UTSW 9 21485723 critical splice donor site probably null
R2346:Dnm2 UTSW 9 21467556 missense probably damaging 1.00
R3711:Dnm2 UTSW 9 21506373 unclassified probably benign
R3796:Dnm2 UTSW 9 21505487 missense probably benign
R4017:Dnm2 UTSW 9 21494604 missense probably damaging 1.00
R4432:Dnm2 UTSW 9 21491304 intron probably benign
R4583:Dnm2 UTSW 9 21504446 missense probably damaging 1.00
R4604:Dnm2 UTSW 9 21504664 critical splice donor site probably null
R4735:Dnm2 UTSW 9 21474587 missense probably damaging 0.99
R4803:Dnm2 UTSW 9 21474629 missense probably damaging 1.00
R4832:Dnm2 UTSW 9 21474679 splice site probably null
R4836:Dnm2 UTSW 9 21491330 intron probably benign
R4937:Dnm2 UTSW 9 21481337 missense probably benign 0.00
R4948:Dnm2 UTSW 9 21504533 missense possibly damaging 0.90
R5059:Dnm2 UTSW 9 21504578 missense probably damaging 1.00
R5291:Dnm2 UTSW 9 21478907 missense probably damaging 1.00
R5538:Dnm2 UTSW 9 21505627 missense probably benign 0.05
R5613:Dnm2 UTSW 9 21472667 missense probably damaging 1.00
R5805:Dnm2 UTSW 9 21467669 missense probably damaging 0.97
R6253:Dnm2 UTSW 9 21500275 missense probably damaging 1.00
R6586:Dnm2 UTSW 9 21505646 missense probably benign 0.32
R6826:Dnm2 UTSW 9 21504471 nonsense probably null
R6855:Dnm2 UTSW 9 21476585 missense probably damaging 1.00
R7121:Dnm2 UTSW 9 21474566 missense probably benign 0.31
R7307:Dnm2 UTSW 9 21485687 missense probably damaging 1.00
R7318:Dnm2 UTSW 9 21505567 missense possibly damaging 0.46
R7467:Dnm2 UTSW 9 21481376 missense probably damaging 1.00
R7619:Dnm2 UTSW 9 21505634 missense probably benign 0.00
R7673:Dnm2 UTSW 9 21481421 critical splice donor site probably null
R8474:Dnm2 UTSW 9 21465720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCAGATCAGGCAGAGAG -3'
(R):5'- TGGTCCTTCTCTGGGTAGAC -3'

Sequencing Primer
(F):5'- AGAGAGCCCCCAGAGCC -3'
(R):5'- GGTAGACCCCAGCACACAGG -3'
Posted On2014-09-18