Incidental Mutation 'R2084:Efemp1'
ID230217
Institutional Source Beutler Lab
Gene Symbol Efemp1
Ensembl Gene ENSMUSG00000020467
Gene Nameepidermal growth factor-containing fibulin-like extracellular matrix protein 1
Synonyms
MMRRC Submission 040089-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2084 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location28853204-28926743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28915763 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 288 (D288G)
Ref Sequence ENSEMBL: ENSMUSP00000020759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020759]
Predicted Effect probably damaging
Transcript: ENSMUST00000020759
AA Change: D288G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020759
Gene: ENSMUSG00000020467
AA Change: D288G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EGF_like 44 76 9.53e-2 SMART
low complexity region 87 104 N/A INTRINSIC
EGF_CA 173 213 5.78e-11 SMART
EGF_CA 214 253 2.35e-11 SMART
EGF_CA 254 293 1.22e-9 SMART
EGF_CA 294 333 1.35e-11 SMART
EGF_like 334 378 3.49e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124103
Predicted Effect unknown
Transcript: ENSMUST00000139713
AA Change: D32G
SMART Domains Protein: ENSMUSP00000114757
Gene: ENSMUSG00000020467
AA Change: D32G

DomainStartEndE-ValueType
EGF 2 38 6.86e-4 SMART
EGF_like 39 83 3.49e-3 SMART
Meta Mutation Damage Score 0.4850 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibulin family of extracellular matrix glycoproteins. Like all members of this family, the encoded protein contains tandemly repeated epidermal growth factor-like repeats followed by a C-terminus fibulin-type domain. This gene is upregulated in malignant gliomas and may play a role in the aggressive nature of these tumors. Mutations in this gene are associated with Doyne honeycomb retinal dystrophy. Alternatively spliced transcript variants that encode the same protein have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. Mice homozygous for a single amino acid substitution develop deposits below the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T C 14: 8,558,171 D138G probably damaging Het
9530053A07Rik G A 7: 28,157,535 V2103M probably damaging Het
Ankrd36 C T 11: 5,662,378 Q1237* probably null Het
Aph1c T G 9: 66,819,297 R258S probably damaging Het
Arfgap3 T A 15: 83,334,566 N102I probably damaging Het
Astn1 T C 1: 158,472,408 V106A probably damaging Het
BC005537 G T 13: 24,812,715 probably null Het
Card10 G A 15: 78,792,971 T412M possibly damaging Het
Cars T C 7: 143,587,182 I126M probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Cpped1 T C 16: 11,828,501 D153G probably damaging Het
Cyp2j11 T A 4: 96,339,201 I193F probably damaging Het
Dnm2 T C 9: 21,500,371 probably null Het
Espl1 T C 15: 102,296,851 probably null Het
Fcrl5 T C 3: 87,444,230 F262L probably benign Het
Gh G A 11: 106,301,132 P84L probably damaging Het
Gm10267 T C 18: 44,157,330 R37G probably benign Het
Gm13089 T A 4: 143,699,350 T8S probably damaging Het
Hmgxb3 C T 18: 61,155,023 probably benign Het
Ifit2 T C 19: 34,573,350 W97R probably damaging Het
Ift81 T G 5: 122,567,347 K491Q probably benign Het
Ints8 A G 4: 11,230,377 V488A probably benign Het
Krba1 T A 6: 48,414,568 L797Q probably damaging Het
Krr1 T C 10: 111,976,785 V100A probably damaging Het
Nav1 C T 1: 135,607,420 probably benign Het
Nos1 C A 5: 117,943,245 Q1205K probably damaging Het
Nup85 A T 11: 115,568,691 D125V possibly damaging Het
Olfr993 T C 2: 85,414,615 E88G probably benign Het
Pclo T G 5: 14,682,148 S3555A probably benign Het
Pdzrn3 T C 6: 101,154,295 I473V probably benign Het
Polr1a A G 6: 71,950,809 E848G possibly damaging Het
Pop1 T C 15: 34,508,598 probably benign Het
Prpf3 C T 3: 95,848,989 E117K probably benign Het
Psmg3 C T 5: 139,823,989 V101M probably benign Het
Rexo1 G A 10: 80,561,266 S52L probably benign Het
Ryk C T 9: 102,875,772 T210M probably damaging Het
Sde2 A G 1: 180,862,633 E306G probably damaging Het
Sec24c A G 14: 20,691,279 Q658R probably benign Het
Sgsm1 G A 5: 113,285,400 T183I probably damaging Het
Skint7 T A 4: 111,980,178 V51E probably damaging Het
Slc6a5 T A 7: 49,948,254 M622K probably benign Het
Slco1a5 T C 6: 142,234,711 H655R probably benign Het
Slco1c1 T A 6: 141,559,852 Y452* probably null Het
Spn T C 7: 127,137,038 E99G probably benign Het
Ssc5d A G 7: 4,937,012 I789V probably benign Het
Taok2 G A 7: 126,870,191 T1155I probably benign Het
Tet2 T C 3: 133,487,767 Q302R possibly damaging Het
Trmt1l A G 1: 151,440,854 T189A probably damaging Het
Tubal3 T C 13: 3,928,192 I36T possibly damaging Het
Vmn2r71 A T 7: 85,618,737 Y133F probably benign Het
Vps11 G T 9: 44,353,261 H673N probably benign Het
Zc3h12a C T 4: 125,120,009 S354N probably benign Het
Zfp2 A G 11: 50,900,962 S85P probably benign Het
Other mutations in Efemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Efemp1 APN 11 28926223 missense probably benign 0.32
IGL01862:Efemp1 APN 11 28921428 missense probably damaging 0.97
IGL02568:Efemp1 APN 11 28916971 critical splice donor site probably null
IGL03175:Efemp1 APN 11 28926259 missense probably benign 0.04
IGL03014:Efemp1 UTSW 11 28926218 missense probably damaging 0.96
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0974:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R1678:Efemp1 UTSW 11 28916942 missense probably benign 0.00
R1701:Efemp1 UTSW 11 28921750 missense possibly damaging 0.68
R1831:Efemp1 UTSW 11 28921442 missense possibly damaging 0.91
R2016:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2017:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2024:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2025:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2027:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2396:Efemp1 UTSW 11 28867941 missense possibly damaging 0.83
R4803:Efemp1 UTSW 11 28921795 missense possibly damaging 0.84
R4817:Efemp1 UTSW 11 28926241 missense probably damaging 1.00
R5201:Efemp1 UTSW 11 28914590 missense probably benign 0.05
R5297:Efemp1 UTSW 11 28867868 missense probably damaging 0.99
R5534:Efemp1 UTSW 11 28867758 missense probably damaging 1.00
R5839:Efemp1 UTSW 11 28921418 missense possibly damaging 0.95
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6314:Efemp1 UTSW 11 28914603 missense probably benign 0.12
R7067:Efemp1 UTSW 11 28867926 missense probably damaging 1.00
R7396:Efemp1 UTSW 11 28867501 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTATCACCAGTTGATCTCAGCAC -3'
(R):5'- GCACCTTGTGTTCCAGCTAC -3'

Sequencing Primer
(F):5'- GTTGATCTCAGCACAAAAAGCAAG -3'
(R):5'- GTGTTCCAGCTACTTGATGCATC -3'
Posted On2014-09-18