Incidental Mutation 'R0179:Unc5c'
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
MMRRC Submission 038447-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0179 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 141818067 bp
Amino Acid Change Arginine to Stop codon at position 794 (R794*)
Ref Sequence ENSEMBL: ENSMUSP00000118212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect probably null
Transcript: ENSMUST00000075282
AA Change: R794*
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: R794*

signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106236
AA Change: R775*
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: R775*

signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000130636
AA Change: R720*
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: R720*

signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142762
AA Change: R794*
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: R794*

signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,214 S516P probably benign Het
4932431P20Rik A G 7: 29,535,940 noncoding transcript Het
Adamts1 C T 16: 85,795,465 S948N probably benign Het
Adck1 A T 12: 88,459,172 M457L possibly damaging Het
Adprm A T 11: 67,038,225 H313Q possibly damaging Het
Adssl1 T C 12: 112,632,269 I104T probably benign Het
Agxt2 A C 15: 10,399,048 Q435P possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Ankrd50 A G 3: 38,455,314 V968A possibly damaging Het
Brf2 T C 8: 27,125,868 D163G possibly damaging Het
Cd226 C A 18: 89,207,139 N53K probably benign Het
Cdc42ep2 T C 19: 5,918,608 D23G probably benign Het
Cdc7 T C 5: 106,965,039 S8P probably benign Het
Cdh8 C T 8: 99,111,712 E499K possibly damaging Het
Chd7 T A 4: 8,862,516 F2534L probably benign Het
Ckb T C 12: 111,670,176 T255A probably benign Het
Cntnap5c G T 17: 57,769,625 W19L probably benign Het
Cntrl A G 2: 35,167,859 E1854G probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cop1 A G 1: 159,250,066 D157G probably benign Het
Csf2rb A C 15: 78,336,372 Q38P possibly damaging Het
Ctla2b T C 13: 60,896,293 D52G possibly damaging Het
Dcaf7 A T 11: 106,051,797 D190V probably damaging Het
Depdc5 T A 5: 32,901,574 probably benign Het
Dgkq A G 5: 108,658,200 probably benign Het
Dhrs2 A G 14: 55,240,476 T222A probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
E4f1 G C 17: 24,451,437 T92S possibly damaging Het
Ep400 A T 5: 110,668,649 S2669T probably damaging Het
Eprs T G 1: 185,413,547 D1184E probably benign Het
Fpr-rs4 A T 17: 18,022,027 K99* probably null Het
Fzr1 A T 10: 81,369,070 probably benign Het
Gcc2 C T 10: 58,276,650 R1001C probably benign Het
Gm4884 A G 7: 41,043,828 D407G probably benign Het
Golga4 A T 9: 118,560,740 probably null Het
Gp2 T G 7: 119,452,317 D225A possibly damaging Het
Gramd1a T A 7: 31,142,418 T120S probably damaging Het
Hbb-bh2 T A 7: 103,839,227 N121I probably benign Het
Htr6 A T 4: 139,062,126 L276Q probably damaging Het
Itga9 A T 9: 118,661,386 I262F probably benign Het
Lamc3 A G 2: 31,915,084 probably benign Het
Large1 T C 8: 73,098,846 N200S probably benign Het
Lct C T 1: 128,327,685 V207I probably benign Het
Marf1 C A 16: 14,151,176 L144F probably damaging Het
Morc2b A T 17: 33,136,982 Y605* probably null Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Muc2 A G 7: 141,748,971 Y17C probably damaging Het
Myf5 T C 10: 107,485,918 D5G possibly damaging Het
Nasp C T 4: 116,602,157 V375M probably damaging Het
Nr1h2 A T 7: 44,552,265 probably null Het
Nrg2 T C 18: 36,022,415 Q447R probably benign Het
Ntn5 G A 7: 45,686,313 G56D probably damaging Het
Oasl2 A G 5: 114,910,912 R138G probably benign Het
Olfr1209 A T 2: 88,909,893 C167S possibly damaging Het
Olfr1489 T A 19: 13,633,140 F10I probably damaging Het
Olfr827 T C 10: 130,210,338 Y264C probably damaging Het
Pcdhb5 G A 18: 37,322,559 G664D probably damaging Het
Ppp1r15a T C 7: 45,525,000 E128G probably damaging Het
Prpf19 T C 19: 10,897,808 probably benign Het
Ptpn3 T A 4: 57,270,118 T15S probably benign Het
R3hdm2 G A 10: 127,495,106 C818Y probably damaging Het
Rad51d A G 11: 82,889,998 V39A possibly damaging Het
Rptor A T 11: 119,872,367 T926S probably benign Het
Rwdd4a G A 8: 47,542,707 D41N probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Ssbp3 T C 4: 107,046,388 S334P probably damaging Het
Suco A G 1: 161,876,305 probably benign Het
Synj1 T C 16: 90,964,631 K649R possibly damaging Het
Tdp2 C T 13: 24,840,448 H243Y possibly damaging Het
Tinag A G 9: 76,996,882 probably benign Het
Trerf1 T C 17: 47,316,662 noncoding transcript Het
Trip10 T C 17: 57,262,349 probably benign Het
Tsen54 A T 11: 115,822,030 S131C probably damaging Het
Vmn2r59 A T 7: 42,047,008 Y103* probably null Het
Washc5 A G 15: 59,352,530 V460A probably benign Het
Whamm A G 7: 81,594,015 T358A probably benign Het
Xlr4b C T X: 73,218,671 probably benign Het
Zbbx C T 3: 75,085,562 probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp27 T A 7: 29,896,425 E38D possibly damaging Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R7936:Unc5c UTSW 3 141828477 missense possibly damaging 0.48
R8041:Unc5c UTSW 3 141465784 missense possibly damaging 0.92
R8277:Unc5c UTSW 3 141768612 critical splice donor site probably null
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141678010 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggagtgttggggattacgag -3'
Posted On2013-04-16