Incidental Mutation 'R0179:1700022I11Rik'
ID23024
Institutional Source Beutler Lab
Gene Symbol 1700022I11Rik
Ensembl Gene ENSMUSG00000028451
Gene NameRIKEN cDNA 1700022I11 gene
Synonyms
MMRRC Submission 038447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0179 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location42969604-42983640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42972214 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 516 (S516P)
Ref Sequence ENSEMBL: ENSMUSP00000030163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030163] [ENSMUST00000139127] [ENSMUST00000185904] [ENSMUST00000190902]
Predicted Effect probably benign
Transcript: ENSMUST00000030163
AA Change: S516P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000030163
Gene: ENSMUSG00000028451
AA Change: S516P

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
internal_repeat_1 322 432 6.53e-5 PROSPERO
low complexity region 434 449 N/A INTRINSIC
low complexity region 507 521 N/A INTRINSIC
low complexity region 599 610 N/A INTRINSIC
internal_repeat_1 622 738 6.53e-5 PROSPERO
low complexity region 847 861 N/A INTRINSIC
low complexity region 897 908 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 944 958 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139127
SMART Domains Protein: ENSMUSP00000116415
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185904
SMART Domains Protein: ENSMUSP00000140492
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:FAM75 99 149 2e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189414
Predicted Effect probably benign
Transcript: ENSMUST00000190902
SMART Domains Protein: ENSMUSP00000140363
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,535,940 noncoding transcript Het
Adamts1 C T 16: 85,795,465 S948N probably benign Het
Adck1 A T 12: 88,459,172 M457L possibly damaging Het
Adprm A T 11: 67,038,225 H313Q possibly damaging Het
Adssl1 T C 12: 112,632,269 I104T probably benign Het
Agxt2 A C 15: 10,399,048 Q435P possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Ankrd50 A G 3: 38,455,314 V968A possibly damaging Het
Brf2 T C 8: 27,125,868 D163G possibly damaging Het
Cd226 C A 18: 89,207,139 N53K probably benign Het
Cdc42ep2 T C 19: 5,918,608 D23G probably benign Het
Cdc7 T C 5: 106,965,039 S8P probably benign Het
Cdh8 C T 8: 99,111,712 E499K possibly damaging Het
Chd7 T A 4: 8,862,516 F2534L probably benign Het
Ckb T C 12: 111,670,176 T255A probably benign Het
Cntnap5c G T 17: 57,769,625 W19L probably benign Het
Cntrl A G 2: 35,167,859 E1854G probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cop1 A G 1: 159,250,066 D157G probably benign Het
Csf2rb A C 15: 78,336,372 Q38P possibly damaging Het
Ctla2b T C 13: 60,896,293 D52G possibly damaging Het
Dcaf7 A T 11: 106,051,797 D190V probably damaging Het
Depdc5 T A 5: 32,901,574 probably benign Het
Dgkq A G 5: 108,658,200 probably benign Het
Dhrs2 A G 14: 55,240,476 T222A probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
E4f1 G C 17: 24,451,437 T92S possibly damaging Het
Ep400 A T 5: 110,668,649 S2669T probably damaging Het
Eprs T G 1: 185,413,547 D1184E probably benign Het
Fpr-rs4 A T 17: 18,022,027 K99* probably null Het
Fzr1 A T 10: 81,369,070 probably benign Het
Gcc2 C T 10: 58,276,650 R1001C probably benign Het
Gm4884 A G 7: 41,043,828 D407G probably benign Het
Golga4 A T 9: 118,560,740 probably null Het
Gp2 T G 7: 119,452,317 D225A possibly damaging Het
Gramd1a T A 7: 31,142,418 T120S probably damaging Het
Hbb-bh2 T A 7: 103,839,227 N121I probably benign Het
Htr6 A T 4: 139,062,126 L276Q probably damaging Het
Itga9 A T 9: 118,661,386 I262F probably benign Het
Lamc3 A G 2: 31,915,084 probably benign Het
Large1 T C 8: 73,098,846 N200S probably benign Het
Lct C T 1: 128,327,685 V207I probably benign Het
Marf1 C A 16: 14,151,176 L144F probably damaging Het
Morc2b A T 17: 33,136,982 Y605* probably null Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Muc2 A G 7: 141,748,971 Y17C probably damaging Het
Myf5 T C 10: 107,485,918 D5G possibly damaging Het
Nasp C T 4: 116,602,157 V375M probably damaging Het
Nr1h2 A T 7: 44,552,265 probably null Het
Nrg2 T C 18: 36,022,415 Q447R probably benign Het
Ntn5 G A 7: 45,686,313 G56D probably damaging Het
Oasl2 A G 5: 114,910,912 R138G probably benign Het
Olfr1209 A T 2: 88,909,893 C167S possibly damaging Het
Olfr1489 T A 19: 13,633,140 F10I probably damaging Het
Olfr827 T C 10: 130,210,338 Y264C probably damaging Het
Pcdhb5 G A 18: 37,322,559 G664D probably damaging Het
Ppp1r15a T C 7: 45,525,000 E128G probably damaging Het
Prpf19 T C 19: 10,897,808 probably benign Het
Ptpn3 T A 4: 57,270,118 T15S probably benign Het
R3hdm2 G A 10: 127,495,106 C818Y probably damaging Het
Rad51d A G 11: 82,889,998 V39A possibly damaging Het
Rptor A T 11: 119,872,367 T926S probably benign Het
Rwdd4a G A 8: 47,542,707 D41N probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Ssbp3 T C 4: 107,046,388 S334P probably damaging Het
Suco A G 1: 161,876,305 probably benign Het
Synj1 T C 16: 90,964,631 K649R possibly damaging Het
Tdp2 C T 13: 24,840,448 H243Y possibly damaging Het
Tinag A G 9: 76,996,882 probably benign Het
Trerf1 T C 17: 47,316,662 noncoding transcript Het
Trip10 T C 17: 57,262,349 probably benign Het
Tsen54 A T 11: 115,822,030 S131C probably damaging Het
Unc5c A T 3: 141,818,067 R794* probably null Het
Vmn2r59 A T 7: 42,047,008 Y103* probably null Het
Washc5 A G 15: 59,352,530 V460A probably benign Het
Whamm A G 7: 81,594,015 T358A probably benign Het
Xlr4b C T X: 73,218,671 probably benign Het
Zbbx C T 3: 75,085,562 probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp27 T A 7: 29,896,425 E38D possibly damaging Het
Other mutations in 1700022I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:1700022I11Rik APN 4 42973982 missense probably benign 0.40
IGL01340:1700022I11Rik APN 4 42971984 missense possibly damaging 0.94
IGL02078:1700022I11Rik APN 4 42972685 missense possibly damaging 0.71
IGL02082:1700022I11Rik APN 4 42970198 missense probably benign 0.00
IGL02993:1700022I11Rik APN 4 42971719 missense probably damaging 0.99
IGL03174:1700022I11Rik APN 4 42970975 missense probably benign 0.00
IGL03188:1700022I11Rik APN 4 42971225 missense possibly damaging 0.56
R0031:1700022I11Rik UTSW 4 42973712 missense probably damaging 0.99
R0409:1700022I11Rik UTSW 4 42972203 missense probably damaging 0.98
R0422:1700022I11Rik UTSW 4 42972199 missense possibly damaging 0.95
R0462:1700022I11Rik UTSW 4 42973429 missense probably benign
R0467:1700022I11Rik UTSW 4 42972715 missense probably benign
R0677:1700022I11Rik UTSW 4 42970952 nonsense probably null
R0723:1700022I11Rik UTSW 4 42971691 missense probably damaging 0.98
R1479:1700022I11Rik UTSW 4 42972543 missense possibly damaging 0.55
R1586:1700022I11Rik UTSW 4 42971512 missense probably benign 0.03
R1956:1700022I11Rik UTSW 4 42970105 splice site probably null
R2030:1700022I11Rik UTSW 4 42974131 nonsense probably null
R2074:1700022I11Rik UTSW 4 42974171 missense probably benign 0.38
R2162:1700022I11Rik UTSW 4 42972238 missense possibly damaging 0.59
R2419:1700022I11Rik UTSW 4 42974146 missense possibly damaging 0.94
R2939:1700022I11Rik UTSW 4 42972946 missense probably benign 0.04
R3615:1700022I11Rik UTSW 4 42971864 missense probably benign 0.10
R3616:1700022I11Rik UTSW 4 42971864 missense probably benign 0.10
R3981:1700022I11Rik UTSW 4 42971534 missense probably damaging 0.99
R5037:1700022I11Rik UTSW 4 42972195 missense probably benign
R5252:1700022I11Rik UTSW 4 42971706 missense probably benign 0.00
R5526:1700022I11Rik UTSW 4 42972125 missense possibly damaging 0.90
R5642:1700022I11Rik UTSW 4 42971831 missense possibly damaging 0.61
R5935:1700022I11Rik UTSW 4 42971465 missense probably benign
R6082:1700022I11Rik UTSW 4 42972511 missense probably benign 0.27
R6136:1700022I11Rik UTSW 4 42972853 missense probably damaging 0.96
R6361:1700022I11Rik UTSW 4 42972695 missense probably benign 0.05
R6494:1700022I11Rik UTSW 4 42971924 missense possibly damaging 0.94
R6641:1700022I11Rik UTSW 4 42971245 missense possibly damaging 0.90
R7289:1700022I11Rik UTSW 4 42972379 missense probably benign 0.00
R7289:1700022I11Rik UTSW 4 42973252 missense possibly damaging 0.66
R7777:1700022I11Rik UTSW 4 42970171 nonsense probably null
R7777:1700022I11Rik UTSW 4 42971095 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACTCACAGTACCCGTGACTGAAG -3'
(R):5'- TCAGATCCCAGTGGGACACACATAG -3'

Sequencing Primer
(F):5'- CCCTGGATATGAAGCTCAGTG -3'
(R):5'- ACACACATAGGTGTGGCTTC -3'
Posted On2013-04-16