Incidental Mutation 'R2085:Prickle2'
ID230255
Institutional Source Beutler Lab
Gene Symbol Prickle2
Ensembl Gene ENSMUSG00000030020
Gene Nameprickle planar cell polarity protein 2
Synonyms6230400G14Rik, mpk2, 6720451F06Rik
MMRRC Submission 040090-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R2085 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location92370908-92706155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92376364 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 763 (E763G)
Ref Sequence ENSEMBL: ENSMUSP00000032093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032093] [ENSMUST00000113445] [ENSMUST00000113446] [ENSMUST00000113447]
Predicted Effect probably damaging
Transcript: ENSMUST00000032093
AA Change: E763G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032093
Gene: ENSMUSG00000030020
AA Change: E763G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:PET 76 176 1.2e-45 PFAM
LIM 185 242 3.05e-10 SMART
LIM 250 302 5.43e-16 SMART
LIM 310 365 2.92e-7 SMART
low complexity region 465 477 N/A INTRINSIC
low complexity region 534 546 N/A INTRINSIC
low complexity region 725 753 N/A INTRINSIC
low complexity region 832 841 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113445
AA Change: E707G

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109072
Gene: ENSMUSG00000030020
AA Change: E707G

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113446
AA Change: E707G

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109073
Gene: ENSMUSG00000030020
AA Change: E707G

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113447
AA Change: E707G

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109074
Gene: ENSMUSG00000030020
AA Change: E707G

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog of Drosophila prickle. The exact function of this gene is not known, however, studies in mice suggest that it may be involved in seizure prevention. Mutations in this gene are associated with progressive myoclonic epilepsy type 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive or PTZ-induced seizures. Mice heterozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik G T 11: 69,900,372 T127K possibly damaging Het
A2m T G 6: 121,676,959 I1417S probably damaging Het
Acad10 A G 5: 121,649,460 I142T possibly damaging Het
Adprm T A 11: 67,041,852 D77V probably damaging Het
Apob C T 12: 8,012,240 T3574I probably damaging Het
Bahcc1 A G 11: 120,288,082 K2489R probably damaging Het
Bub1b A G 2: 118,622,195 E443G possibly damaging Het
Cd9 A T 6: 125,463,771 probably null Het
Cgnl1 G A 9: 71,630,878 T1194M probably damaging Het
Clec9a T C 6: 129,410,311 V43A probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Dpep3 A G 8: 105,974,714 V401A probably damaging Het
Duox2 G T 2: 122,280,967 H1417N probably damaging Het
Efhb C T 17: 53,426,909 probably null Het
F2r T C 13: 95,604,910 N39S probably benign Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Galt G A 4: 41,758,162 R309Q probably damaging Het
Gas2l2 C A 11: 83,427,383 A167S probably benign Het
Hecw1 A T 13: 14,264,087 F904I possibly damaging Het
Herc2 C A 7: 56,212,965 H4127Q possibly damaging Het
Hipk1 T C 3: 103,750,354 T805A probably benign Het
Hivep1 A G 13: 42,183,750 E2435G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep2 C A 10: 14,139,529 C1813* probably null Het
Hyal4 C T 6: 24,755,750 probably benign Het
Inpp4b A G 8: 81,952,274 Y311C probably damaging Het
Itih4 A G 14: 30,892,323 Y410C possibly damaging Het
Lama2 A T 10: 27,204,841 C995* probably null Het
Lingo4 C A 3: 94,402,245 D163E probably damaging Het
Malt1 A G 18: 65,473,147 D642G probably damaging Het
Mbd4 T A 6: 115,848,957 M358L probably benign Het
Mbd5 T A 2: 49,279,311 F1498Y possibly damaging Het
Me1 T C 9: 86,613,554 Q280R probably damaging Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr186 C T 16: 59,027,869 V13I probably benign Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Olfr62 T C 4: 118,666,104 S196P probably damaging Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr905 A G 9: 38,472,927 Y60C probably damaging Het
Polr2j T C 5: 136,116,771 F7L probably damaging Het
Ppp1r16a T A 15: 76,693,596 D303E probably damaging Het
Rdh11 T C 12: 79,182,782 Y239C possibly damaging Het
Sdhaf3 A G 6: 6,956,048 R8G probably benign Het
Sgk2 T C 2: 163,012,970 S305P probably damaging Het
Sptbn2 A G 19: 4,738,559 S1189G probably benign Het
Stab2 A G 10: 86,954,159 L581P probably damaging Het
Tifab T C 13: 56,176,297 Q111R probably damaging Het
Ubr3 C T 2: 69,953,764 R775C probably damaging Het
Usp17lb T A 7: 104,840,415 Q434L possibly damaging Het
Wdr46 G T 17: 33,941,451 E135* probably null Het
Zfp318 T A 17: 46,409,664 probably null Het
Zfp874a T A 13: 67,442,848 H239L probably damaging Het
Zscan29 A T 2: 121,169,946 L60* probably null Het
Other mutations in Prickle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02962:Prickle2 APN 6 92376422 missense probably benign 0.00
R0028:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R0122:Prickle2 UTSW 6 92411345 nonsense probably null
R0555:Prickle2 UTSW 6 92458565 missense probably benign 0.02
R0940:Prickle2 UTSW 6 92411003 missense probably benign 0.02
R1394:Prickle2 UTSW 6 92376382 missense possibly damaging 0.87
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1599:Prickle2 UTSW 6 92410874 missense probably benign
R1745:Prickle2 UTSW 6 92376593 missense probably damaging 1.00
R1801:Prickle2 UTSW 6 92416904 missense probably damaging 0.98
R1985:Prickle2 UTSW 6 92411452 missense probably damaging 1.00
R2147:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2148:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2571:Prickle2 UTSW 6 92705400 missense probably benign 0.09
R3547:Prickle2 UTSW 6 92411137 missense probably damaging 1.00
R4356:Prickle2 UTSW 6 92411509 missense probably damaging 1.00
R4569:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R4896:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5004:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5045:Prickle2 UTSW 6 92376394 missense probably damaging 0.96
R5219:Prickle2 UTSW 6 92376530 missense probably benign
R5247:Prickle2 UTSW 6 92375969 missense probably damaging 1.00
R5280:Prickle2 UTSW 6 92376210 missense probably damaging 1.00
R5334:Prickle2 UTSW 6 92425684 missense probably damaging 1.00
R5780:Prickle2 UTSW 6 92458612 missense probably benign 0.06
R5960:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R6084:Prickle2 UTSW 6 92416848 nonsense probably null
R6362:Prickle2 UTSW 6 92458615 missense possibly damaging 0.77
R6368:Prickle2 UTSW 6 92420237 missense probably damaging 1.00
R6852:Prickle2 UTSW 6 92376544 missense probably benign
R7041:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R7203:Prickle2 UTSW 6 92410978 missense possibly damaging 0.61
R7352:Prickle2 UTSW 6 92410890 missense probably benign 0.00
R7405:Prickle2 UTSW 6 92458543 missense probably damaging 0.96
R7510:Prickle2 UTSW 6 92376470 missense possibly damaging 0.58
R7562:Prickle2 UTSW 6 92375948 makesense probably null
R7578:Prickle2 UTSW 6 92411290 missense probably benign 0.32
R7614:Prickle2 UTSW 6 92425650 missense possibly damaging 0.46
R7732:Prickle2 UTSW 6 92411224 missense probably damaging 1.00
X0020:Prickle2 UTSW 6 92416853 missense probably damaging 0.98
X0026:Prickle2 UTSW 6 92411426 nonsense probably null
X0066:Prickle2 UTSW 6 92376433 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATACTCCGTGAAGTAGGGTCCC -3'
(R):5'- AGGATGCACCAGAGCTTTG -3'

Sequencing Primer
(F):5'- TGAAGTAGGGTCCCCATCGTTC -3'
(R):5'- ATGCACCAGAGCTTTGATTTTG -3'
Posted On2014-09-18