Incidental Mutation 'R2085:Olfr905'
ID230265
Institutional Source Beutler Lab
Gene Symbol Olfr905
Ensembl Gene ENSMUSG00000096794
Gene Nameolfactory receptor 905
SynonymsMOR167-1, GA_x6K02T2PVTD-32165709-32166641
MMRRC Submission 040090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2085 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38471107-38477013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38472927 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000150357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051111] [ENSMUST00000214377] [ENSMUST00000216724]
Predicted Effect probably damaging
Transcript: ENSMUST00000051111
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057998
Gene: ENSMUSG00000096794
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-50 PFAM
Pfam:7tm_1 41 298 4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214377
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216724
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik G T 11: 69,900,372 T127K possibly damaging Het
A2m T G 6: 121,676,959 I1417S probably damaging Het
Acad10 A G 5: 121,649,460 I142T possibly damaging Het
Adprm T A 11: 67,041,852 D77V probably damaging Het
Apob C T 12: 8,012,240 T3574I probably damaging Het
Bahcc1 A G 11: 120,288,082 K2489R probably damaging Het
Bub1b A G 2: 118,622,195 E443G possibly damaging Het
Cd9 A T 6: 125,463,771 probably null Het
Cgnl1 G A 9: 71,630,878 T1194M probably damaging Het
Clec9a T C 6: 129,410,311 V43A probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Dpep3 A G 8: 105,974,714 V401A probably damaging Het
Duox2 G T 2: 122,280,967 H1417N probably damaging Het
Efhb C T 17: 53,426,909 probably null Het
F2r T C 13: 95,604,910 N39S probably benign Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Galt G A 4: 41,758,162 R309Q probably damaging Het
Gas2l2 C A 11: 83,427,383 A167S probably benign Het
Hecw1 A T 13: 14,264,087 F904I possibly damaging Het
Herc2 C A 7: 56,212,965 H4127Q possibly damaging Het
Hipk1 T C 3: 103,750,354 T805A probably benign Het
Hivep1 A G 13: 42,183,750 E2435G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep2 C A 10: 14,139,529 C1813* probably null Het
Hyal4 C T 6: 24,755,750 probably benign Het
Inpp4b A G 8: 81,952,274 Y311C probably damaging Het
Itih4 A G 14: 30,892,323 Y410C possibly damaging Het
Lama2 A T 10: 27,204,841 C995* probably null Het
Lingo4 C A 3: 94,402,245 D163E probably damaging Het
Malt1 A G 18: 65,473,147 D642G probably damaging Het
Mbd4 T A 6: 115,848,957 M358L probably benign Het
Mbd5 T A 2: 49,279,311 F1498Y possibly damaging Het
Me1 T C 9: 86,613,554 Q280R probably damaging Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr186 C T 16: 59,027,869 V13I probably benign Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Olfr62 T C 4: 118,666,104 S196P probably damaging Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Polr2j T C 5: 136,116,771 F7L probably damaging Het
Ppp1r16a T A 15: 76,693,596 D303E probably damaging Het
Prickle2 T C 6: 92,376,364 E763G probably damaging Het
Rdh11 T C 12: 79,182,782 Y239C possibly damaging Het
Sdhaf3 A G 6: 6,956,048 R8G probably benign Het
Sgk2 T C 2: 163,012,970 S305P probably damaging Het
Sptbn2 A G 19: 4,738,559 S1189G probably benign Het
Stab2 A G 10: 86,954,159 L581P probably damaging Het
Tifab T C 13: 56,176,297 Q111R probably damaging Het
Ubr3 C T 2: 69,953,764 R775C probably damaging Het
Usp17lb T A 7: 104,840,415 Q434L possibly damaging Het
Wdr46 G T 17: 33,941,451 E135* probably null Het
Zfp318 T A 17: 46,409,664 probably null Het
Zfp874a T A 13: 67,442,848 H239L probably damaging Het
Zscan29 A T 2: 121,169,946 L60* probably null Het
Other mutations in Olfr905
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr905 APN 9 38473042 missense possibly damaging 0.52
IGL03168:Olfr905 APN 9 38473019 missense probably benign
R0003:Olfr905 UTSW 9 38473316 missense probably benign 0.24
R0062:Olfr905 UTSW 9 38473258 missense probably benign 0.03
R0625:Olfr905 UTSW 9 38473208 missense possibly damaging 0.90
R0744:Olfr905 UTSW 9 38472785 missense probably benign 0.04
R0836:Olfr905 UTSW 9 38472785 missense probably benign 0.04
R2898:Olfr905 UTSW 9 38472975 missense probably damaging 0.99
R4462:Olfr905 UTSW 9 38473064 missense probably benign 0.32
R4655:Olfr905 UTSW 9 38472824 missense probably damaging 0.99
R5209:Olfr905 UTSW 9 38473521 missense possibly damaging 0.52
R5759:Olfr905 UTSW 9 38473535 missense possibly damaging 0.73
R6453:Olfr905 UTSW 9 38473575 missense probably benign 0.18
R6501:Olfr905 UTSW 9 38473289 missense possibly damaging 0.88
R6934:Olfr905 UTSW 9 38473176 missense probably benign
R6999:Olfr905 UTSW 9 38473239 missense probably damaging 1.00
R7295:Olfr905 UTSW 9 38473443 missense probably benign 0.07
R7677:Olfr905 UTSW 9 38473535 missense possibly damaging 0.73
R7708:Olfr905 UTSW 9 38473385 missense probably damaging 1.00
R7843:Olfr905 UTSW 9 38472947 missense probably damaging 0.99
R7926:Olfr905 UTSW 9 38472947 missense probably damaging 0.99
X0053:Olfr905 UTSW 9 38473176 missense probably benign
X0065:Olfr905 UTSW 9 38473006 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTGGCCTGGGTTCACAGATTC -3'
(R):5'- AGCGATCATAGGCCATTGAGG -3'

Sequencing Primer
(F):5'- GCCTGGGTTCACAGATTCCTTTAAAG -3'
(R):5'- GCCATTGAGGTCAAAATGTAACACTC -3'
Posted On2014-09-18