Incidental Mutation 'R2085:Cgnl1'
ID230266
Institutional Source Beutler Lab
Gene Symbol Cgnl1
Ensembl Gene ENSMUSG00000032232
Gene Namecingulin-like 1
SynonymsJacop, 9930020M10Rik, 4933421H10Rik
MMRRC Submission 040090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2085 (G1)
Quality Score127
Status Not validated
Chromosome9
Chromosomal Location71626509-71771602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71630878 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1194 (T1194M)
Ref Sequence ENSEMBL: ENSMUSP00000112479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]
Predicted Effect probably damaging
Transcript: ENSMUST00000072899
AA Change: T1194M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: T1194M

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
Pfam:Myosin_tail_1 984 1255 5.4e-30 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121322
AA Change: T1123M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: T1123M

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
Pfam:Myosin_tail_1 909 1184 2.3e-30 PFAM
low complexity region 1187 1207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122065
AA Change: T1194M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: T1194M

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
Pfam:Myosin_tail_1 582 1034 1.3e-12 PFAM
Pfam:Myosin_tail_1 1011 1253 7.7e-38 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152224
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik G T 11: 69,900,372 T127K possibly damaging Het
A2m T G 6: 121,676,959 I1417S probably damaging Het
Acad10 A G 5: 121,649,460 I142T possibly damaging Het
Adprm T A 11: 67,041,852 D77V probably damaging Het
Apob C T 12: 8,012,240 T3574I probably damaging Het
Bahcc1 A G 11: 120,288,082 K2489R probably damaging Het
Bub1b A G 2: 118,622,195 E443G possibly damaging Het
Cd9 A T 6: 125,463,771 probably null Het
Clec9a T C 6: 129,410,311 V43A probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Dpep3 A G 8: 105,974,714 V401A probably damaging Het
Duox2 G T 2: 122,280,967 H1417N probably damaging Het
Efhb C T 17: 53,426,909 probably null Het
F2r T C 13: 95,604,910 N39S probably benign Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Galt G A 4: 41,758,162 R309Q probably damaging Het
Gas2l2 C A 11: 83,427,383 A167S probably benign Het
Hecw1 A T 13: 14,264,087 F904I possibly damaging Het
Herc2 C A 7: 56,212,965 H4127Q possibly damaging Het
Hipk1 T C 3: 103,750,354 T805A probably benign Het
Hivep1 A G 13: 42,183,750 E2435G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep2 C A 10: 14,139,529 C1813* probably null Het
Hyal4 C T 6: 24,755,750 probably benign Het
Inpp4b A G 8: 81,952,274 Y311C probably damaging Het
Itih4 A G 14: 30,892,323 Y410C possibly damaging Het
Lama2 A T 10: 27,204,841 C995* probably null Het
Lingo4 C A 3: 94,402,245 D163E probably damaging Het
Malt1 A G 18: 65,473,147 D642G probably damaging Het
Mbd4 T A 6: 115,848,957 M358L probably benign Het
Mbd5 T A 2: 49,279,311 F1498Y possibly damaging Het
Me1 T C 9: 86,613,554 Q280R probably damaging Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr186 C T 16: 59,027,869 V13I probably benign Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Olfr62 T C 4: 118,666,104 S196P probably damaging Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr905 A G 9: 38,472,927 Y60C probably damaging Het
Polr2j T C 5: 136,116,771 F7L probably damaging Het
Ppp1r16a T A 15: 76,693,596 D303E probably damaging Het
Prickle2 T C 6: 92,376,364 E763G probably damaging Het
Rdh11 T C 12: 79,182,782 Y239C possibly damaging Het
Sdhaf3 A G 6: 6,956,048 R8G probably benign Het
Sgk2 T C 2: 163,012,970 S305P probably damaging Het
Sptbn2 A G 19: 4,738,559 S1189G probably benign Het
Stab2 A G 10: 86,954,159 L581P probably damaging Het
Tifab T C 13: 56,176,297 Q111R probably damaging Het
Ubr3 C T 2: 69,953,764 R775C probably damaging Het
Usp17lb T A 7: 104,840,415 Q434L possibly damaging Het
Wdr46 G T 17: 33,941,451 E135* probably null Het
Zfp318 T A 17: 46,409,664 probably null Het
Zfp874a T A 13: 67,442,848 H239L probably damaging Het
Zscan29 A T 2: 121,169,946 L60* probably null Het
Other mutations in Cgnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cgnl1 APN 9 71656056 missense probably benign 0.00
IGL01128:Cgnl1 APN 9 71724561 missense possibly damaging 0.81
IGL01450:Cgnl1 APN 9 71631862 splice site probably benign
IGL01788:Cgnl1 APN 9 71655390 missense probably benign
IGL01806:Cgnl1 APN 9 71650322 missense probably damaging 0.99
IGL01906:Cgnl1 APN 9 71724567 missense probably benign 0.00
IGL01933:Cgnl1 APN 9 71645483 splice site probably benign
IGL01939:Cgnl1 APN 9 71725004 missense probably damaging 1.00
IGL01947:Cgnl1 APN 9 71725044 missense probably damaging 0.99
IGL02127:Cgnl1 APN 9 71725853 missense probably damaging 1.00
IGL02379:Cgnl1 APN 9 71645553 missense possibly damaging 0.82
IGL02510:Cgnl1 APN 9 71725357 missense probably benign 0.41
FR4548:Cgnl1 UTSW 9 71724717 small insertion probably benign
R0058:Cgnl1 UTSW 9 71641397 missense probably damaging 1.00
R0058:Cgnl1 UTSW 9 71724840 missense probably damaging 0.99
R0105:Cgnl1 UTSW 9 71656102 missense probably benign
R0220:Cgnl1 UTSW 9 71724943 missense possibly damaging 0.68
R0242:Cgnl1 UTSW 9 71721657 missense probably damaging 1.00
R0401:Cgnl1 UTSW 9 71705239 missense probably damaging 1.00
R0541:Cgnl1 UTSW 9 71651253 missense possibly damaging 0.54
R1018:Cgnl1 UTSW 9 71726058 missense probably damaging 1.00
R1026:Cgnl1 UTSW 9 71717431 missense possibly damaging 0.91
R1056:Cgnl1 UTSW 9 71725895 missense probably damaging 1.00
R1299:Cgnl1 UTSW 9 71721712 splice site probably benign
R1513:Cgnl1 UTSW 9 71724590 missense probably benign 0.02
R1546:Cgnl1 UTSW 9 71725815 missense probably benign
R1599:Cgnl1 UTSW 9 71641427 missense probably benign 0.02
R1657:Cgnl1 UTSW 9 71725944 missense probably damaging 0.98
R1970:Cgnl1 UTSW 9 71725535 missense probably benign 0.10
R2004:Cgnl1 UTSW 9 71630539 missense probably damaging 1.00
R2080:Cgnl1 UTSW 9 71656096 missense probably benign 0.01
R2357:Cgnl1 UTSW 9 71725668 nonsense probably null
R2402:Cgnl1 UTSW 9 71725179 missense probably damaging 1.00
R3954:Cgnl1 UTSW 9 71724663 missense probably benign 0.01
R4043:Cgnl1 UTSW 9 71705293 missense probably damaging 1.00
R4127:Cgnl1 UTSW 9 71724540 missense probably benign 0.00
R4825:Cgnl1 UTSW 9 71630524 missense probably benign 0.00
R4851:Cgnl1 UTSW 9 71725032 missense probably damaging 1.00
R4882:Cgnl1 UTSW 9 71717401 missense probably benign 0.00
R4996:Cgnl1 UTSW 9 71724826 small deletion probably benign
R5057:Cgnl1 UTSW 9 71724794 missense probably damaging 0.99
R5263:Cgnl1 UTSW 9 71632654 nonsense probably null
R5402:Cgnl1 UTSW 9 71629321 missense probably damaging 1.00
R5744:Cgnl1 UTSW 9 71630675 intron probably null
R5770:Cgnl1 UTSW 9 71645487 splice site probably null
R6911:Cgnl1 UTSW 9 71656215 missense possibly damaging 0.82
R7014:Cgnl1 UTSW 9 71725134 missense possibly damaging 0.86
R7106:Cgnl1 UTSW 9 71725733 missense probably benign 0.00
R7203:Cgnl1 UTSW 9 71724533 missense possibly damaging 0.80
R7231:Cgnl1 UTSW 9 71632645 missense probably benign 0.39
R7241:Cgnl1 UTSW 9 71724770 missense probably benign
R7288:Cgnl1 UTSW 9 71725564 missense possibly damaging 0.67
R7327:Cgnl1 UTSW 9 71725883 missense possibly damaging 0.48
R7390:Cgnl1 UTSW 9 71645649 missense probably benign 0.04
R7529:Cgnl1 UTSW 9 71631758 missense probably damaging 1.00
R7793:Cgnl1 UTSW 9 71725635 missense probably damaging 1.00
RF015:Cgnl1 UTSW 9 71724715 small insertion probably benign
RF042:Cgnl1 UTSW 9 71724715 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTGTTAGCTCGATGGAAAAGCC -3'
(R):5'- TATGGCTGGAGTGTCCCATCTC -3'

Sequencing Primer
(F):5'- GCCAGAGTAGGAGATGCCG -3'
(R):5'- GGAGTGTCCCATCTCCTCCTTC -3'
Posted On2014-09-18