Mutagenetix > Incidental Mutations

Incidental Mutation 'R0179:Depdc5'

23029

Institutional Source

Beutler Lab

Gene Symbol

Depdc5

Ensembl Gene

ENSMUSG00000037426

Gene Name

DEP domain containing 5

Synonyms

MMRRC Submission

038447-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0179 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32863701-32994236 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 32901574 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000195980]

Predicted Effect

probably benign
Transcript: ENSMUST00000049780

SMART Domains

Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-64	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087897

SMART Domains

Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	2.3e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	826	836	N/A	INTRINSIC
low complexity region	994	1006	N/A	INTRINSIC
low complexity region	1159	1175	N/A	INTRINSIC
DEP	1184	1259	2.49e-15	SMART
low complexity region	1322	1335	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119705

SMART Domains

Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3e-117	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1150	1166	N/A	INTRINSIC
DEP	1175	1250	2.49e-15	SMART
low complexity region	1313	1326	N/A	INTRINSIC
low complexity region	1511	1525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120902

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139098

Predicted Effect

probably benign
Transcript: ENSMUST00000195980

SMART Domains

Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	147	4e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201802

Predicted Effect

probably benign
Transcript: ENSMUST00000201836

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,972,214	S516P	probably benign	Het
4932431P20Rik	A	G	7: 29,535,940		noncoding transcript	Het
Adamts1	C	T	16: 85,795,465	S948N	probably benign	Het
Adck1	A	T	12: 88,459,172	M457L	possibly damaging	Het
Adprm	A	T	11: 67,038,225	H313Q	possibly damaging	Het
Adssl1	T	C	12: 112,632,269	I104T	probably benign	Het
Agxt2	A	C	15: 10,399,048	Q435P	possibly damaging	Het
Amotl1	G	A	9: 14,548,773	A890V	probably benign	Het
Ankrd50	A	G	3: 38,455,314	V968A	possibly damaging	Het
Brf2	T	C	8: 27,125,868	D163G	possibly damaging	Het
Cd226	C	A	18: 89,207,139	N53K	probably benign	Het
Cdc42ep2	T	C	19: 5,918,608	D23G	probably benign	Het
Cdc7	T	C	5: 106,965,039	S8P	probably benign	Het
Cdh8	C	T	8: 99,111,712	E499K	possibly damaging	Het
Chd7	T	A	4: 8,862,516	F2534L	probably benign	Het
Ckb	T	C	12: 111,670,176	T255A	probably benign	Het
Cntnap5c	G	T	17: 57,769,625	W19L	probably benign	Het
Cntrl	A	G	2: 35,167,859	E1854G	probably benign	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cop1	A	G	1: 159,250,066	D157G	probably benign	Het
Csf2rb	A	C	15: 78,336,372	Q38P	possibly damaging	Het
Ctla2b	T	C	13: 60,896,293	D52G	possibly damaging	Het
Dcaf7	A	T	11: 106,051,797	D190V	probably damaging	Het
Dgkq	A	G	5: 108,658,200		probably benign	Het
Dhrs2	A	G	14: 55,240,476	T222A	probably damaging	Het
Dock1	G	A	7: 135,098,837	D1109N	probably damaging	Het
E4f1	G	C	17: 24,451,437	T92S	possibly damaging	Het
Ep400	A	T	5: 110,668,649	S2669T	probably damaging	Het
Eprs	T	G	1: 185,413,547	D1184E	probably benign	Het
Fpr-rs4	A	T	17: 18,022,027	K99*	probably null	Het
Fzr1	A	T	10: 81,369,070		probably benign	Het
Gcc2	C	T	10: 58,276,650	R1001C	probably benign	Het
Gm4884	A	G	7: 41,043,828	D407G	probably benign	Het
Golga4	A	T	9: 118,560,740		probably null	Het
Gp2	T	G	7: 119,452,317	D225A	possibly damaging	Het
Gramd1a	T	A	7: 31,142,418	T120S	probably damaging	Het
Hbb-bh2	T	A	7: 103,839,227	N121I	probably benign	Het
Htr6	A	T	4: 139,062,126	L276Q	probably damaging	Het
Itga9	A	T	9: 118,661,386	I262F	probably benign	Het
Lamc3	A	G	2: 31,915,084		probably benign	Het
Large1	T	C	8: 73,098,846	N200S	probably benign	Het
Lct	C	T	1: 128,327,685	V207I	probably benign	Het
Marf1	C	A	16: 14,151,176	L144F	probably damaging	Het
Morc2b	A	T	17: 33,136,982	Y605*	probably null	Het
Mtus1	G	T	8: 41,002,361	L87I	possibly damaging	Het
Muc2	A	G	7: 141,748,971	Y17C	probably damaging	Het
Myf5	T	C	10: 107,485,918	D5G	possibly damaging	Het
Nasp	C	T	4: 116,602,157	V375M	probably damaging	Het
Nr1h2	A	T	7: 44,552,265		probably null	Het
Nrg2	T	C	18: 36,022,415	Q447R	probably benign	Het
Ntn5	G	A	7: 45,686,313	G56D	probably damaging	Het
Oasl2	A	G	5: 114,910,912	R138G	probably benign	Het
Olfr1209	A	T	2: 88,909,893	C167S	possibly damaging	Het
Olfr1489	T	A	19: 13,633,140	F10I	probably damaging	Het
Olfr827	T	C	10: 130,210,338	Y264C	probably damaging	Het
Pcdhb5	G	A	18: 37,322,559	G664D	probably damaging	Het
Ppp1r15a	T	C	7: 45,525,000	E128G	probably damaging	Het
Prpf19	T	C	19: 10,897,808		probably benign	Het
Ptpn3	T	A	4: 57,270,118	T15S	probably benign	Het
R3hdm2	G	A	10: 127,495,106	C818Y	probably damaging	Het
Rad51d	A	G	11: 82,889,998	V39A	possibly damaging	Het
Rptor	A	T	11: 119,872,367	T926S	probably benign	Het
Rwdd4a	G	A	8: 47,542,707	D41N	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Ssbp3	T	C	4: 107,046,388	S334P	probably damaging	Het
Suco	A	G	1: 161,876,305		probably benign	Het
Synj1	T	C	16: 90,964,631	K649R	possibly damaging	Het
Tdp2	C	T	13: 24,840,448	H243Y	possibly damaging	Het
Tinag	A	G	9: 76,996,882		probably benign	Het
Trerf1	T	C	17: 47,316,662		noncoding transcript	Het
Trip10	T	C	17: 57,262,349		probably benign	Het
Tsen54	A	T	11: 115,822,030	S131C	probably damaging	Het
Unc5c	A	T	3: 141,818,067	R794*	probably null	Het
Vmn2r59	A	T	7: 42,047,008	Y103*	probably null	Het
Washc5	A	G	15: 59,352,530	V460A	probably benign	Het
Whamm	A	G	7: 81,594,015	T358A	probably benign	Het
Xlr4b	C	T	X: 73,218,671		probably benign	Het
Zbbx	C	T	3: 75,085,562		probably benign	Het
Zdhhc23	G	A	16: 43,973,703	P203S	probably benign	Het
Zfp27	T	A	7: 29,896,425	E38D	possibly damaging	Het

Other mutations in Depdc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Depdc5	APN	5	32967814	splice site	probably null
IGL01019:Depdc5	APN	5	32893401	missense	probably damaging	0.96
IGL01067:Depdc5	APN	5	32899067	splice site	probably null
IGL01405:Depdc5	APN	5	32937689	missense	possibly damaging	0.90
IGL01577:Depdc5	APN	5	32955897	missense	possibly damaging	0.49
IGL01633:Depdc5	APN	5	32924200	missense	probably damaging	1.00
IGL01998:Depdc5	APN	5	32945151	splice site	probably benign
IGL02025:Depdc5	APN	5	32946632	critical splice acceptor site	probably null
IGL02167:Depdc5	APN	5	32903801	missense	probably damaging	1.00
IGL02537:Depdc5	APN	5	32967787	missense	probably damaging	1.00
IGL02812:Depdc5	APN	5	32893368	splice site	probably benign
IGL03001:Depdc5	APN	5	32945090	missense	possibly damaging	0.74
IGL03253:Depdc5	APN	5	32868813	unclassified	probably benign
IGL02988:Depdc5	UTSW	5	32956167	utr 3 prime	probably null
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0153:Depdc5	UTSW	5	32933937	splice site	probably benign
R0212:Depdc5	UTSW	5	32912242	missense	probably benign	0.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0302:Depdc5	UTSW	5	32904546	critical splice donor site	probably benign
R0511:Depdc5	UTSW	5	32945028	nonsense	probably null
R0677:Depdc5	UTSW	5	32901470	missense	probably damaging	1.00
R0884:Depdc5	UTSW	5	32917978	missense	possibly damaging	0.94
R0973:Depdc5	UTSW	5	32986966	missense	possibly damaging	0.92
R1314:Depdc5	UTSW	5	32877074	missense	probably damaging	1.00
R1611:Depdc5	UTSW	5	32990953	missense	probably damaging	1.00
R1687:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1748:Depdc5	UTSW	5	32917942	missense	probably benign	0.24
R1903:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1956:Depdc5	UTSW	5	32903831	missense	probably damaging	1.00
R1997:Depdc5	UTSW	5	32901906	critical splice donor site	probably null
R2079:Depdc5	UTSW	5	32946674	missense	possibly damaging	0.75
R2131:Depdc5	UTSW	5	32990781	nonsense	probably null
R2291:Depdc5	UTSW	5	32979402	missense	probably damaging	1.00
R2422:Depdc5	UTSW	5	32991035	missense	probably damaging	1.00
R2851:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2852:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2937:Depdc5	UTSW	5	32901621	intron	probably null
R2938:Depdc5	UTSW	5	32901621	intron	probably null
R2974:Depdc5	UTSW	5	32934017	critical splice donor site	probably null
R3884:Depdc5	UTSW	5	32944077	missense	probably damaging	1.00
R3967:Depdc5	UTSW	5	32944115	nonsense	probably null
R4118:Depdc5	UTSW	5	32964635	missense	probably damaging	1.00
R4197:Depdc5	UTSW	5	32991203	missense	possibly damaging	0.93
R4407:Depdc5	UTSW	5	32904534	critical splice donor site	probably null
R4534:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4535:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4538:Depdc5	UTSW	5	32983946	missense	probably damaging	1.00
R4613:Depdc5	UTSW	5	32975446	missense	probably damaging	1.00
R4736:Depdc5	UTSW	5	32975322	missense	probably benign
R4738:Depdc5	UTSW	5	32975322	missense	probably benign
R4765:Depdc5	UTSW	5	32937635	missense	probably damaging	1.00
R5021:Depdc5	UTSW	5	32979414	missense	probably damaging	1.00
R5259:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5261:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5541:Depdc5	UTSW	5	32864629	utr 5 prime	probably benign
R5594:Depdc5	UTSW	5	32901490	missense	possibly damaging	0.46
R5929:Depdc5	UTSW	5	32975506	nonsense	probably null
R6132:Depdc5	UTSW	5	32910467	missense	probably damaging	0.99
R6146:Depdc5	UTSW	5	32968731	missense	probably benign	0.01
R6336:Depdc5	UTSW	5	32964507	unclassified	probably null
R6468:Depdc5	UTSW	5	32912231	missense	probably benign	0.02
R6911:Depdc5	UTSW	5	32924192	missense	probably damaging	1.00
R6969:Depdc5	UTSW	5	32983860	missense	probably damaging	1.00
R7002:Depdc5	UTSW	5	32877158	splice site	probably null
R7066:Depdc5	UTSW	5	32901848	missense	probably benign	0.08
R7231:Depdc5	UTSW	5	32901865	missense	possibly damaging	0.92
R7264:Depdc5	UTSW	5	32967745	missense	probably benign
R7302:Depdc5	UTSW	5	32979508	missense	probably damaging	1.00
R7386:Depdc5	UTSW	5	32927936	missense	probably benign
R7564:Depdc5	UTSW	5	32901510	missense	probably damaging	1.00
R7636:Depdc5	UTSW	5	32917983	missense	probably benign
R7795:Depdc5	UTSW	5	32944103	missense	probably damaging	1.00
R7845:Depdc5	UTSW	5	32903915	splice site	probably null
R8013:Depdc5	UTSW	5	32973842	missense	probably benign	0.01
R8037:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8038:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8065:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8067:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8108:Depdc5	UTSW	5	32945049	missense	probably benign	0.01
R8112:Depdc5	UTSW	5	32968706	missense	possibly damaging	0.67
R8213:Depdc5	UTSW	5	32937637	missense	probably damaging	1.00
X0027:Depdc5	UTSW	5	32904292	missense	probably damaging	1.00
Z1176:Depdc5	UTSW	5	32943282	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CCTCTCTTGAAACTTTGTCATGAGCCTG -3'
(R):5'- CCTTGTGCTGAGGTAGAATTGTCTCC -3'

Sequencing Primer
(F):5'- ACTTTGTCATGAGCCTGATAGC -3'
(R):5'- gctaggtggtggaggctc -3'

Posted On

2013-04-16