Incidental Mutation 'R2085:Wdr46'
ID230294
Institutional Source Beutler Lab
Gene Symbol Wdr46
Ensembl Gene ENSMUSG00000024312
Gene NameWD repeat domain 46
SynonymsBing4, 2310007I04Rik
MMRRC Submission 040090-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R2085 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33940660-33949695 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 33941451 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 135 (E135*)
Ref Sequence ENSEMBL: ENSMUSP00000025170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000174426] [ENSMUST00000179418]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000025170
AA Change: E135*
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312
AA Change: E135*

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172546
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik G T 11: 69,900,372 T127K possibly damaging Het
A2m T G 6: 121,676,959 I1417S probably damaging Het
Acad10 A G 5: 121,649,460 I142T possibly damaging Het
Adprm T A 11: 67,041,852 D77V probably damaging Het
Apob C T 12: 8,012,240 T3574I probably damaging Het
Bahcc1 A G 11: 120,288,082 K2489R probably damaging Het
Bub1b A G 2: 118,622,195 E443G possibly damaging Het
Cd9 A T 6: 125,463,771 probably null Het
Cgnl1 G A 9: 71,630,878 T1194M probably damaging Het
Clec9a T C 6: 129,410,311 V43A probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Dpep3 A G 8: 105,974,714 V401A probably damaging Het
Duox2 G T 2: 122,280,967 H1417N probably damaging Het
Efhb C T 17: 53,426,909 probably null Het
F2r T C 13: 95,604,910 N39S probably benign Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Galt G A 4: 41,758,162 R309Q probably damaging Het
Gas2l2 C A 11: 83,427,383 A167S probably benign Het
Hecw1 A T 13: 14,264,087 F904I possibly damaging Het
Herc2 C A 7: 56,212,965 H4127Q possibly damaging Het
Hipk1 T C 3: 103,750,354 T805A probably benign Het
Hivep1 A G 13: 42,183,750 E2435G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep2 C A 10: 14,139,529 C1813* probably null Het
Hyal4 C T 6: 24,755,750 probably benign Het
Inpp4b A G 8: 81,952,274 Y311C probably damaging Het
Itih4 A G 14: 30,892,323 Y410C possibly damaging Het
Lama2 A T 10: 27,204,841 C995* probably null Het
Lingo4 C A 3: 94,402,245 D163E probably damaging Het
Malt1 A G 18: 65,473,147 D642G probably damaging Het
Mbd4 T A 6: 115,848,957 M358L probably benign Het
Mbd5 T A 2: 49,279,311 F1498Y possibly damaging Het
Me1 T C 9: 86,613,554 Q280R probably damaging Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr186 C T 16: 59,027,869 V13I probably benign Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Olfr62 T C 4: 118,666,104 S196P probably damaging Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr905 A G 9: 38,472,927 Y60C probably damaging Het
Polr2j T C 5: 136,116,771 F7L probably damaging Het
Ppp1r16a T A 15: 76,693,596 D303E probably damaging Het
Prickle2 T C 6: 92,376,364 E763G probably damaging Het
Rdh11 T C 12: 79,182,782 Y239C possibly damaging Het
Sdhaf3 A G 6: 6,956,048 R8G probably benign Het
Sgk2 T C 2: 163,012,970 S305P probably damaging Het
Sptbn2 A G 19: 4,738,559 S1189G probably benign Het
Stab2 A G 10: 86,954,159 L581P probably damaging Het
Tifab T C 13: 56,176,297 Q111R probably damaging Het
Ubr3 C T 2: 69,953,764 R775C probably damaging Het
Usp17lb T A 7: 104,840,415 Q434L possibly damaging Het
Zfp318 T A 17: 46,409,664 probably null Het
Zfp874a T A 13: 67,442,848 H239L probably damaging Het
Zscan29 A T 2: 121,169,946 L60* probably null Het
Other mutations in Wdr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0147:Wdr46 UTSW 17 33941023 missense probably benign
R0148:Wdr46 UTSW 17 33941023 missense probably benign
R1405:Wdr46 UTSW 17 33949083 missense probably damaging 1.00
R1405:Wdr46 UTSW 17 33949083 missense probably damaging 1.00
R4319:Wdr46 UTSW 17 33940744 missense probably benign 0.04
R4368:Wdr46 UTSW 17 33941146 unclassified probably benign
R4831:Wdr46 UTSW 17 33941836 missense probably benign 0.17
R4831:Wdr46 UTSW 17 33949399 unclassified probably benign
R5118:Wdr46 UTSW 17 33948837 missense possibly damaging 0.65
R6211:Wdr46 UTSW 17 33944485 missense probably damaging 1.00
R6347:Wdr46 UTSW 17 33941852 missense probably damaging 1.00
R6529:Wdr46 UTSW 17 33949146 missense possibly damaging 0.78
R7318:Wdr46 UTSW 17 33941885 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGACAAGTCCAAAACGGTGAG -3'
(R):5'- TCCACGATGTCTGTCTGCAG -3'

Sequencing Primer
(F):5'- CCCACATATGCTCTTCGG -3'
(R):5'- TACCAGAAACCTAAAAGGCAGTTAG -3'
Posted On2014-09-18