Incidental Mutation 'R2085:Efhb'
ID230296
Institutional Source Beutler Lab
Gene Symbol Efhb
Ensembl Gene ENSMUSG00000023931
Gene NameEF hand domain family, member B
Synonyms4921525D22Rik
MMRRC Submission 040090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2085 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location53398889-53463321 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 53426909 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024725]
Predicted Effect probably null
Transcript: ENSMUST00000024725
SMART Domains Protein: ENSMUSP00000024725
Gene: ENSMUSG00000023931

DomainStartEndE-ValueType
low complexity region 565 574 N/A INTRINSIC
EFh 585 613 2.14e-1 SMART
EFh 621 649 1.98e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik G T 11: 69,900,372 T127K possibly damaging Het
A2m T G 6: 121,676,959 I1417S probably damaging Het
Acad10 A G 5: 121,649,460 I142T possibly damaging Het
Adprm T A 11: 67,041,852 D77V probably damaging Het
Apob C T 12: 8,012,240 T3574I probably damaging Het
Bahcc1 A G 11: 120,288,082 K2489R probably damaging Het
Bub1b A G 2: 118,622,195 E443G possibly damaging Het
Cd9 A T 6: 125,463,771 probably null Het
Cgnl1 G A 9: 71,630,878 T1194M probably damaging Het
Clec9a T C 6: 129,410,311 V43A probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Dpep3 A G 8: 105,974,714 V401A probably damaging Het
Duox2 G T 2: 122,280,967 H1417N probably damaging Het
F2r T C 13: 95,604,910 N39S probably benign Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Galt G A 4: 41,758,162 R309Q probably damaging Het
Gas2l2 C A 11: 83,427,383 A167S probably benign Het
Hecw1 A T 13: 14,264,087 F904I possibly damaging Het
Herc2 C A 7: 56,212,965 H4127Q possibly damaging Het
Hipk1 T C 3: 103,750,354 T805A probably benign Het
Hivep1 A G 13: 42,183,750 E2435G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep2 C A 10: 14,139,529 C1813* probably null Het
Hyal4 C T 6: 24,755,750 probably benign Het
Inpp4b A G 8: 81,952,274 Y311C probably damaging Het
Itih4 A G 14: 30,892,323 Y410C possibly damaging Het
Lama2 A T 10: 27,204,841 C995* probably null Het
Lingo4 C A 3: 94,402,245 D163E probably damaging Het
Malt1 A G 18: 65,473,147 D642G probably damaging Het
Mbd4 T A 6: 115,848,957 M358L probably benign Het
Mbd5 T A 2: 49,279,311 F1498Y possibly damaging Het
Me1 T C 9: 86,613,554 Q280R probably damaging Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr186 C T 16: 59,027,869 V13I probably benign Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Olfr62 T C 4: 118,666,104 S196P probably damaging Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr905 A G 9: 38,472,927 Y60C probably damaging Het
Polr2j T C 5: 136,116,771 F7L probably damaging Het
Ppp1r16a T A 15: 76,693,596 D303E probably damaging Het
Prickle2 T C 6: 92,376,364 E763G probably damaging Het
Rdh11 T C 12: 79,182,782 Y239C possibly damaging Het
Sdhaf3 A G 6: 6,956,048 R8G probably benign Het
Sgk2 T C 2: 163,012,970 S305P probably damaging Het
Sptbn2 A G 19: 4,738,559 S1189G probably benign Het
Stab2 A G 10: 86,954,159 L581P probably damaging Het
Tifab T C 13: 56,176,297 Q111R probably damaging Het
Ubr3 C T 2: 69,953,764 R775C probably damaging Het
Usp17lb T A 7: 104,840,415 Q434L possibly damaging Het
Wdr46 G T 17: 33,941,451 E135* probably null Het
Zfp318 T A 17: 46,409,664 probably null Het
Zfp874a T A 13: 67,442,848 H239L probably damaging Het
Zscan29 A T 2: 121,169,946 L60* probably null Het
Other mutations in Efhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Efhb APN 17 53462453 missense probably damaging 1.00
IGL00990:Efhb APN 17 53462621 missense possibly damaging 0.86
IGL02041:Efhb APN 17 53426259 missense probably damaging 1.00
IGL02247:Efhb APN 17 53401624 missense probably benign 0.00
IGL02637:Efhb APN 17 53449552 missense probably benign 0.26
IGL02704:Efhb APN 17 53426269 missense probably damaging 1.00
IGL03083:Efhb APN 17 53399059 missense probably damaging 1.00
IGL03090:Efhb APN 17 53462930 missense probably benign 0.01
IGL03221:Efhb APN 17 53398986 missense probably damaging 1.00
PIT4531001:Efhb UTSW 17 53445775 missense probably damaging 1.00
R0632:Efhb UTSW 17 53413459 splice site probably benign
R1234:Efhb UTSW 17 53451587 nonsense probably null
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1471:Efhb UTSW 17 53399112 missense possibly damaging 0.46
R1624:Efhb UTSW 17 53426278 missense probably damaging 1.00
R2019:Efhb UTSW 17 53401477 missense probably damaging 1.00
R2226:Efhb UTSW 17 53462429 critical splice donor site probably null
R2415:Efhb UTSW 17 53463096 missense probably benign 0.01
R3848:Efhb UTSW 17 53426996 splice site probably benign
R3858:Efhb UTSW 17 53462780 missense possibly damaging 0.61
R4581:Efhb UTSW 17 53426275 missense probably damaging 1.00
R4712:Efhb UTSW 17 53451669 missense probably damaging 1.00
R4731:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4732:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4733:Efhb UTSW 17 53426244 missense probably damaging 1.00
R5375:Efhb UTSW 17 53401626 missense possibly damaging 0.93
R5886:Efhb UTSW 17 53451554 missense probably benign 0.42
R6054:Efhb UTSW 17 53398999 missense possibly damaging 0.90
R6195:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6233:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6450:Efhb UTSW 17 53452604 missense possibly damaging 0.77
R6550:Efhb UTSW 17 53421940 missense probably benign 0.06
R6701:Efhb UTSW 17 53399063 missense probably benign 0.41
R6967:Efhb UTSW 17 53463168 missense probably benign 0.03
R7157:Efhb UTSW 17 53400900 missense probably damaging 1.00
R7441:Efhb UTSW 17 53401521 missense possibly damaging 0.78
R7694:Efhb UTSW 17 53400808 missense probably damaging 0.99
R8044:Efhb UTSW 17 53399115 missense probably benign 0.41
R8176:Efhb UTSW 17 53400846 missense probably damaging 1.00
R8309:Efhb UTSW 17 53449535 missense probably damaging 0.99
R8311:Efhb UTSW 17 53413461 critical splice donor site probably null
R8821:Efhb UTSW 17 53400744 critical splice donor site probably benign
R8882:Efhb UTSW 17 53462684 missense probably damaging 1.00
RF003:Efhb UTSW 17 53400891 missense probably damaging 1.00
RF012:Efhb UTSW 17 53413517 missense probably damaging 0.97
Z1177:Efhb UTSW 17 53437126 missense possibly damaging 0.94
Z1177:Efhb UTSW 17 53437183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTGGTAAGACACAACCCAACATTTG -3'
(R):5'- GACTTGTTCACTGAGGGTGCAG -3'

Sequencing Primer
(F):5'- GGTTTTTCAATTTAGCCCAGATTG -3'
(R):5'- AGGGTGCAGTTATACCATGATCC -3'
Posted On2014-09-18