Incidental Mutation 'R2097:Olfr1051'
ID 230302
Institutional Source Beutler Lab
Gene Symbol Olfr1051
Ensembl Gene ENSMUSG00000075193
Gene Name olfactory receptor 1051
Synonyms GA_x6K02T2Q125-47756192-47755266, MOR187-5
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 86273814-86279088 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 86276039 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 149 (Y149*)
Ref Sequence ENSEMBL: ENSMUSP00000150061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099898] [ENSMUST00000216432] [ENSMUST00000217245] [ENSMUST00000217294]
AlphaFold Q7TR76
Predicted Effect probably null
Transcript: ENSMUST00000099898
AA Change: Y149*
SMART Domains Protein: ENSMUSP00000097482
Gene: ENSMUSG00000075193
AA Change: Y149*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-53 PFAM
Pfam:7tm_1 41 290 2.7e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216432
AA Change: Y149*
Predicted Effect probably null
Transcript: ENSMUST00000217245
AA Change: Y149*
Predicted Effect probably null
Transcript: ENSMUST00000217294
AA Change: Y149*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Olfr1051
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01578:Olfr1051 APN 2 86275741 missense probably damaging 0.99
IGL02263:Olfr1051 APN 2 86276202 missense probably benign 0.01
IGL03143:Olfr1051 APN 2 86276236 missense probably benign 0.03
R1182:Olfr1051 UTSW 2 86276268 missense probably damaging 0.98
R1475:Olfr1051 UTSW 2 86275561 makesense probably null
R1712:Olfr1051 UTSW 2 86275993 missense probably damaging 0.97
R1903:Olfr1051 UTSW 2 86275846 missense probably benign 0.00
R4680:Olfr1051 UTSW 2 86276173 missense possibly damaging 0.88
R4879:Olfr1051 UTSW 2 86275763 nonsense probably null
R5094:Olfr1051 UTSW 2 86276040 missense probably damaging 1.00
R6448:Olfr1051 UTSW 2 86276347 missense probably benign 0.07
R8250:Olfr1051 UTSW 2 86276154 missense probably damaging 1.00
R9525:Olfr1051 UTSW 2 86276140 missense probably benign 0.22
R9761:Olfr1051 UTSW 2 86275806 missense probably benign 0.06
X0064:Olfr1051 UTSW 2 86276118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTACCTTCTGCAGAACG -3'
(R):5'- ACCTATTATGCTTGTGCCACAC -3'

Sequencing Primer
(F):5'- CAGAACGCATTCGAAATATGGTTAAC -3'
(R):5'- ATGCTTGTGCCACACAGATG -3'
Posted On 2014-09-18