Incidental Mutation 'R2097:Nbea'
ID230303
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Nameneurobeachin
Synonyms
MMRRC Submission 040101-MU
Accession Numbers

Genbank: NM_030595

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2097 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location55625195-56183701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55723217 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2233 (D2233G)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
Predicted Effect probably damaging
Transcript: ENSMUST00000029374
AA Change: D2233G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: D2233G

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199535
Meta Mutation Damage Score 0.2447 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55628493 missense probably damaging 1.00
IGL00541:Nbea APN 3 55968089 missense probably benign 0.02
IGL00584:Nbea APN 3 56082448 missense probably damaging 0.98
IGL00648:Nbea APN 3 56009260 missense probably damaging 0.98
IGL00785:Nbea APN 3 55955393 missense probably benign
IGL00899:Nbea APN 3 55642845 missense probably benign 0.32
IGL00955:Nbea APN 3 56005472 missense possibly damaging 0.45
IGL01296:Nbea APN 3 56031536 missense probably benign 0.04
IGL01299:Nbea APN 3 55690894 missense probably damaging 1.00
IGL01393:Nbea APN 3 56005308 missense probably benign 0.02
IGL01550:Nbea APN 3 55805248 missense possibly damaging 0.93
IGL02023:Nbea APN 3 55681016 missense probably damaging 1.00
IGL02034:Nbea APN 3 55968156 missense probably damaging 1.00
IGL02061:Nbea APN 3 55717887 missense possibly damaging 0.54
IGL02082:Nbea APN 3 55968167 missense possibly damaging 0.88
IGL02113:Nbea APN 3 55992492 missense probably benign
IGL02188:Nbea APN 3 55983837 missense probably benign 0.00
IGL02319:Nbea APN 3 55985738 missense probably damaging 1.00
IGL02406:Nbea APN 3 56086266 missense probably benign 0.02
IGL02494:Nbea APN 3 55805351 missense probably benign 0.02
IGL02550:Nbea APN 3 56019414 missense probably damaging 0.98
IGL02706:Nbea APN 3 56037278 missense probably damaging 1.00
IGL02718:Nbea APN 3 55632062 nonsense probably null
IGL02822:Nbea APN 3 56019447 missense possibly damaging 0.93
IGL02885:Nbea APN 3 55631986 missense probably benign 0.01
IGL03000:Nbea APN 3 56004627 missense possibly damaging 0.94
IGL03081:Nbea APN 3 56079918 missense probably damaging 1.00
IGL03091:Nbea APN 3 56085304 missense probably damaging 1.00
IGL03368:Nbea APN 3 56079930 missense probably damaging 0.98
Neches UTSW 3 55953034 critical splice donor site probably null
FR4340:Nbea UTSW 3 56009212 critical splice donor site probably benign
G4846:Nbea UTSW 3 56087497 missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55717869 missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55701527 intron probably benign
R0087:Nbea UTSW 3 56091023 missense possibly damaging 0.92
R0220:Nbea UTSW 3 56005303 missense probably benign 0.30
R0324:Nbea UTSW 3 56057948 critical splice donor site probably null
R0330:Nbea UTSW 3 55642817 missense probably benign 0.27
R0391:Nbea UTSW 3 56037277 missense probably damaging 1.00
R0394:Nbea UTSW 3 56029907 missense probably damaging 1.00
R0419:Nbea UTSW 3 55819294 missense probably benign 0.05
R0503:Nbea UTSW 3 55642836 missense possibly damaging 0.79
R0521:Nbea UTSW 3 56008268 missense probably damaging 1.00
R0595:Nbea UTSW 3 55628496 missense probably benign 0.18
R0894:Nbea UTSW 3 56009340 missense possibly damaging 0.89
R1072:Nbea UTSW 3 56086196 missense possibly damaging 0.94
R1125:Nbea UTSW 3 55857006 nonsense probably null
R1169:Nbea UTSW 3 55968323 missense probably benign 0.00
R1241:Nbea UTSW 3 56058040 missense probably damaging 1.00
R1269:Nbea UTSW 3 56004781 missense probably benign 0.05
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1457:Nbea UTSW 3 56085327 missense probably damaging 1.00
R1482:Nbea UTSW 3 56079993 missense probably damaging 1.00
R1483:Nbea UTSW 3 56002790 missense probably benign 0.25
R1502:Nbea UTSW 3 56004889 missense probably benign 0.03
R1544:Nbea UTSW 3 56058827 missense probably damaging 0.99
R1629:Nbea UTSW 3 56002891 missense possibly damaging 0.52
R1647:Nbea UTSW 3 55630229 missense probably damaging 0.97
R1663:Nbea UTSW 3 55645986 missense possibly damaging 0.95
R1722:Nbea UTSW 3 55665695 missense probably damaging 1.00
R1757:Nbea UTSW 3 55630189 missense possibly damaging 0.83
R1771:Nbea UTSW 3 55934519 missense probably benign 0.00
R1796:Nbea UTSW 3 55643708 missense possibly damaging 0.48
R1844:Nbea UTSW 3 56082436 missense probably damaging 0.97
R1872:Nbea UTSW 3 55642889 missense probably benign 0.12
R1938:Nbea UTSW 3 56085322 missense probably damaging 1.00
R1940:Nbea UTSW 3 55953100 missense possibly damaging 0.78
R2062:Nbea UTSW 3 56086157 splice site probably benign
R2066:Nbea UTSW 3 55968146 missense probably damaging 1.00
R2181:Nbea UTSW 3 56029939 missense possibly damaging 0.92
R2274:Nbea UTSW 3 55988085 splice site probably null
R2345:Nbea UTSW 3 56085279 missense probably damaging 1.00
R2423:Nbea UTSW 3 56085306 missense probably damaging 1.00
R2434:Nbea UTSW 3 55647460 missense possibly damaging 0.91
R2880:Nbea UTSW 3 55647358 missense probably benign 0.04
R2881:Nbea UTSW 3 55647358 missense probably benign 0.04
R2940:Nbea UTSW 3 55934624 missense probably benign 0.24
R3500:Nbea UTSW 3 55681010 missense possibly damaging 0.88
R3765:Nbea UTSW 3 56005549 missense probably damaging 1.00
R3790:Nbea UTSW 3 56005029 missense probably benign
R3808:Nbea UTSW 3 55717848 missense probably benign 0.02
R3845:Nbea UTSW 3 56086292 splice site probably benign
R4182:Nbea UTSW 3 56008427 missense probably damaging 0.99
R4385:Nbea UTSW 3 56000638 missense possibly damaging 0.77
R4419:Nbea UTSW 3 56009600 missense probably damaging 1.00
R4426:Nbea UTSW 3 56082379 missense probably damaging 0.98
R4451:Nbea UTSW 3 55992332 critical splice donor site probably null
R4456:Nbea UTSW 3 55643784 missense probably benign 0.00
R4604:Nbea UTSW 3 55723648 missense probably benign 0.18
R4687:Nbea UTSW 3 56058065 missense probably damaging 1.00
R4758:Nbea UTSW 3 56005403 missense probably benign
R4840:Nbea UTSW 3 55710670 missense probably benign 0.37
R4888:Nbea UTSW 3 56005355 missense possibly damaging 0.61
R4954:Nbea UTSW 3 56035958 missense probably damaging 1.00
R4972:Nbea UTSW 3 56085246 missense probably damaging 0.99
R4980:Nbea UTSW 3 55647351 splice site probably null
R4980:Nbea UTSW 3 55953045 missense probably benign 0.00
R5104:Nbea UTSW 3 56079927 missense probably damaging 1.00
R5139:Nbea UTSW 3 55626963 missense possibly damaging 0.90
R5166:Nbea UTSW 3 56019453 missense probably damaging 1.00
R5347:Nbea UTSW 3 56040876 missense probably damaging 1.00
R5350:Nbea UTSW 3 56019424 missense probably damaging 1.00
R5418:Nbea UTSW 3 55645989 missense possibly damaging 0.86
R5586:Nbea UTSW 3 55631971 missense probably benign 0.08
R5627:Nbea UTSW 3 55992345 missense probably damaging 1.00
R5683:Nbea UTSW 3 55628586 missense possibly damaging 0.53
R5765:Nbea UTSW 3 56005298 missense probably benign 0.15
R5853:Nbea UTSW 3 55992401 missense probably damaging 1.00
R5858:Nbea UTSW 3 55953034 critical splice donor site probably null
R5955:Nbea UTSW 3 55680983 missense probably benign 0.00
R5976:Nbea UTSW 3 55853847 missense probably benign 0.30
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6043:Nbea UTSW 3 55786475 missense probably benign 0.32
R6122:Nbea UTSW 3 56029896 missense probably damaging 1.00
R6218:Nbea UTSW 3 55628484 missense probably damaging 0.97
R6331:Nbea UTSW 3 56000616 missense possibly damaging 0.94
R6334:Nbea UTSW 3 56037149 missense probably damaging 1.00
R6393:Nbea UTSW 3 56091119 missense probably damaging 1.00
R6411:Nbea UTSW 3 55805357 missense probably benign 0.01
R6457:Nbea UTSW 3 56000569 missense probably damaging 1.00
R6476:Nbea UTSW 3 56004806 missense probably benign 0.00
R6488:Nbea UTSW 3 55717843 missense probably damaging 0.99
R6700:Nbea UTSW 3 56082448 missense possibly damaging 0.89
R6702:Nbea UTSW 3 56005502 missense probably benign 0.06
R6752:Nbea UTSW 3 55968309 missense probably benign 0.02
R6752:Nbea UTSW 3 56037219 missense probably benign
R6804:Nbea UTSW 3 56087453 missense probably benign 0.37
R6901:Nbea UTSW 3 56019415 missense probably damaging 1.00
R6933:Nbea UTSW 3 55723610 missense possibly damaging 0.63
R7124:Nbea UTSW 3 55992444 missense probably damaging 1.00
R7211:Nbea UTSW 3 56004901 missense probably benign 0.05
R7308:Nbea UTSW 3 56091031 missense probably damaging 1.00
R7405:Nbea UTSW 3 55805266 missense possibly damaging 0.94
R7669:Nbea UTSW 3 55717779 missense probably damaging 1.00
R7762:Nbea UTSW 3 55649705 missense probably damaging 1.00
R7833:Nbea UTSW 3 56002797 missense probably damaging 1.00
R7885:Nbea UTSW 3 55665689 missense probably damaging 0.97
R7916:Nbea UTSW 3 56002797 missense probably damaging 1.00
R7932:Nbea UTSW 3 55990875 intron probably null
R7968:Nbea UTSW 3 55665689 missense probably damaging 0.97
R8050:Nbea UTSW 3 55987981 missense probably damaging 0.99
R8108:Nbea UTSW 3 55819315 missense probably benign 0.11
RF051:Nbea UTSW 3 56009212 critical splice donor site probably benign
X0018:Nbea UTSW 3 56036048 missense probably benign 0.39
Z1088:Nbea UTSW 3 55723163 missense probably benign 0.34
Z1177:Nbea UTSW 3 56031550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCCATAATGTCCTTCCCTACAG -3'
(R):5'- GCTGTCACCAAAGCCAAGTG -3'

Sequencing Primer
(F):5'- TGTCCTTCCCTACAGATAATCCACAG -3'
(R):5'- GTCACCAAAGCCAAGTGTGTTTG -3'
Posted On2014-09-18