Incidental Mutation 'R2097:Gfm1'
ID 230304
Institutional Source Beutler Lab
Gene Symbol Gfm1
Ensembl Gene ENSMUSG00000027774
Gene Name G elongation factor, mitochondrial 1
Synonyms D3Wsu133e
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 67430096-67476529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67449746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 384 (I384T)
Ref Sequence ENSEMBL: ENSMUSP00000076503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077271]
AlphaFold Q8K0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000077271
AA Change: I384T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076503
Gene: ENSMUSG00000027774
AA Change: I384T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.5e-65 PFAM
Pfam:GTP_EFTU_D2 366 432 6e-18 PFAM
Pfam:EFG_II 446 520 1.9e-31 PFAM
EFG_IV 522 642 1.64e-47 SMART
EFG_C 644 731 2.16e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161009
SMART Domains Protein: ENSMUSP00000125161
Gene: ENSMUSG00000027774

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.4e-63 PFAM
Pfam:GTP_EFTU_D2 366 432 4.1e-18 PFAM
Pfam:EFG_II 446 520 4.4e-33 PFAM
Meta Mutation Damage Score 0.6613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Gfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Gfm1 APN 3 67438560 missense possibly damaging 0.79
IGL01377:Gfm1 APN 3 67474753 missense probably damaging 1.00
IGL01397:Gfm1 APN 3 67443658 missense probably benign 0.09
IGL01738:Gfm1 APN 3 67456661 missense probably benign 0.15
IGL02679:Gfm1 APN 3 67474767 missense possibly damaging 0.56
IGL03271:Gfm1 APN 3 67474743 missense probably damaging 1.00
R0389:Gfm1 UTSW 3 67457918 missense probably benign 0.00
R0815:Gfm1 UTSW 3 67474595 missense probably damaging 1.00
R0863:Gfm1 UTSW 3 67474595 missense probably damaging 1.00
R1626:Gfm1 UTSW 3 67438644 missense probably damaging 1.00
R1843:Gfm1 UTSW 3 67435610 missense probably damaging 1.00
R1931:Gfm1 UTSW 3 67456585 missense probably benign 0.44
R2149:Gfm1 UTSW 3 67474560 missense probably damaging 1.00
R2337:Gfm1 UTSW 3 67435514 missense probably damaging 1.00
R3739:Gfm1 UTSW 3 67456700 missense probably damaging 1.00
R4193:Gfm1 UTSW 3 67431720 missense probably damaging 1.00
R4661:Gfm1 UTSW 3 67433398 missense probably damaging 1.00
R5023:Gfm1 UTSW 3 67473544 missense probably damaging 1.00
R5057:Gfm1 UTSW 3 67473544 missense probably damaging 1.00
R5503:Gfm1 UTSW 3 67453727 critical splice donor site probably null
R5692:Gfm1 UTSW 3 67435622 missense probably damaging 1.00
R5771:Gfm1 UTSW 3 67435562 missense probably benign 0.11
R6232:Gfm1 UTSW 3 67467882 missense possibly damaging 0.52
R6234:Gfm1 UTSW 3 67435514 missense probably damaging 1.00
R6514:Gfm1 UTSW 3 67473546 missense probably benign
R6911:Gfm1 UTSW 3 67451303 missense possibly damaging 0.83
R7295:Gfm1 UTSW 3 67440181 missense probably benign 0.30
R7899:Gfm1 UTSW 3 67473527 missense probably benign 0.10
R8321:Gfm1 UTSW 3 67430261 missense probably benign
R8465:Gfm1 UTSW 3 67431699 missense probably damaging 1.00
R8473:Gfm1 UTSW 3 67453718 missense possibly damaging 0.71
R9745:Gfm1 UTSW 3 67451324 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCCATGGCTATATGGTGAATTGATAC -3'
(R):5'- CACGTCTGAGCATAAAGGAAGC -3'

Sequencing Primer
(F):5'- TCTGGAGGTAGCCGAAAA -3'
(R):5'- CTGAGCATAAAGGAAGCGAGGAAAG -3'
Posted On 2014-09-18