Incidental Mutation 'R2097:Gfm1'
ID 230304
Institutional Source Beutler Lab
Gene Symbol Gfm1
Ensembl Gene ENSMUSG00000027774
Gene Name G elongation factor, mitochondrial 1
Synonyms D3Wsu133e
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 67337448-67382401 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67357079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 384 (I384T)
Ref Sequence ENSEMBL: ENSMUSP00000076503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077271]
AlphaFold Q8K0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000077271
AA Change: I384T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076503
Gene: ENSMUSG00000027774
AA Change: I384T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.5e-65 PFAM
Pfam:GTP_EFTU_D2 366 432 6e-18 PFAM
Pfam:EFG_II 446 520 1.9e-31 PFAM
EFG_IV 522 642 1.64e-47 SMART
EFG_C 644 731 2.16e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161009
SMART Domains Protein: ENSMUSP00000125161
Gene: ENSMUSG00000027774

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.4e-63 PFAM
Pfam:GTP_EFTU_D2 366 432 4.1e-18 PFAM
Pfam:EFG_II 446 520 4.4e-33 PFAM
Meta Mutation Damage Score 0.6613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Gfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Gfm1 APN 3 67,345,893 (GRCm39) missense possibly damaging 0.79
IGL01377:Gfm1 APN 3 67,382,086 (GRCm39) missense probably damaging 1.00
IGL01397:Gfm1 APN 3 67,350,991 (GRCm39) missense probably benign 0.09
IGL01738:Gfm1 APN 3 67,363,994 (GRCm39) missense probably benign 0.15
IGL02679:Gfm1 APN 3 67,382,100 (GRCm39) missense possibly damaging 0.56
IGL03271:Gfm1 APN 3 67,382,076 (GRCm39) missense probably damaging 1.00
R0389:Gfm1 UTSW 3 67,365,251 (GRCm39) missense probably benign 0.00
R0815:Gfm1 UTSW 3 67,381,928 (GRCm39) missense probably damaging 1.00
R0863:Gfm1 UTSW 3 67,381,928 (GRCm39) missense probably damaging 1.00
R1626:Gfm1 UTSW 3 67,345,977 (GRCm39) missense probably damaging 1.00
R1843:Gfm1 UTSW 3 67,342,943 (GRCm39) missense probably damaging 1.00
R1931:Gfm1 UTSW 3 67,363,918 (GRCm39) missense probably benign 0.44
R2149:Gfm1 UTSW 3 67,381,893 (GRCm39) missense probably damaging 1.00
R2337:Gfm1 UTSW 3 67,342,847 (GRCm39) missense probably damaging 1.00
R3739:Gfm1 UTSW 3 67,364,033 (GRCm39) missense probably damaging 1.00
R4193:Gfm1 UTSW 3 67,339,053 (GRCm39) missense probably damaging 1.00
R4661:Gfm1 UTSW 3 67,340,731 (GRCm39) missense probably damaging 1.00
R5023:Gfm1 UTSW 3 67,380,877 (GRCm39) missense probably damaging 1.00
R5057:Gfm1 UTSW 3 67,380,877 (GRCm39) missense probably damaging 1.00
R5503:Gfm1 UTSW 3 67,361,060 (GRCm39) critical splice donor site probably null
R5692:Gfm1 UTSW 3 67,342,955 (GRCm39) missense probably damaging 1.00
R5771:Gfm1 UTSW 3 67,342,895 (GRCm39) missense probably benign 0.11
R6232:Gfm1 UTSW 3 67,375,215 (GRCm39) missense possibly damaging 0.52
R6234:Gfm1 UTSW 3 67,342,847 (GRCm39) missense probably damaging 1.00
R6514:Gfm1 UTSW 3 67,380,879 (GRCm39) missense probably benign
R6911:Gfm1 UTSW 3 67,358,636 (GRCm39) missense possibly damaging 0.83
R7295:Gfm1 UTSW 3 67,347,514 (GRCm39) missense probably benign 0.30
R7899:Gfm1 UTSW 3 67,380,860 (GRCm39) missense probably benign 0.10
R8321:Gfm1 UTSW 3 67,337,594 (GRCm39) missense probably benign
R8465:Gfm1 UTSW 3 67,339,032 (GRCm39) missense probably damaging 1.00
R8473:Gfm1 UTSW 3 67,361,051 (GRCm39) missense possibly damaging 0.71
R9745:Gfm1 UTSW 3 67,358,657 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCCATGGCTATATGGTGAATTGATAC -3'
(R):5'- CACGTCTGAGCATAAAGGAAGC -3'

Sequencing Primer
(F):5'- TCTGGAGGTAGCCGAAAA -3'
(R):5'- CTGAGCATAAAGGAAGCGAGGAAAG -3'
Posted On 2014-09-18