Incidental Mutation 'R2097:Pglyrp3'
ID 230305
Institutional Source Beutler Lab
Gene Symbol Pglyrp3
Ensembl Gene ENSMUSG00000042244
Gene Name peptidoglycan recognition protein 3
Synonyms LOC242100
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 91921890-91938889 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 91935478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 243 (F243I)
Ref Sequence ENSEMBL: ENSMUSP00000035737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047660]
AlphaFold A1A547
Predicted Effect possibly damaging
Transcript: ENSMUST00000047660
AA Change: F243I

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035737
Gene: ENSMUSG00000042244
AA Change: F243I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PGRP 28 169 2.64e-45 SMART
Ami_2 39 169 1.06e-2 SMART
PGRP 185 326 3.23e-72 SMART
Ami_2 195 332 1.75e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118636
Meta Mutation Damage Score 0.4007 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. These proteins are part of the innate immune system and recognize peptidoglycan, a ubiquitous component of bacterial cell walls. This antimicrobial protein binds to murein peptidoglycans of Gram-positive bacteria. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Pglyrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Pglyrp3 APN 3 91,929,986 (GRCm39) missense probably damaging 0.96
IGL00769:Pglyrp3 APN 3 91,921,929 (GRCm39) utr 5 prime probably benign
IGL02491:Pglyrp3 APN 3 91,921,944 (GRCm39) missense possibly damaging 0.77
IGL03279:Pglyrp3 APN 3 91,933,834 (GRCm39) missense probably damaging 1.00
R0056:Pglyrp3 UTSW 3 91,933,111 (GRCm39) splice site probably benign
R1128:Pglyrp3 UTSW 3 91,935,479 (GRCm39) missense probably benign 0.22
R2140:Pglyrp3 UTSW 3 91,933,874 (GRCm39) missense probably benign 0.00
R3697:Pglyrp3 UTSW 3 91,935,481 (GRCm39) missense probably damaging 1.00
R4369:Pglyrp3 UTSW 3 91,935,386 (GRCm39) missense probably damaging 1.00
R4430:Pglyrp3 UTSW 3 91,938,798 (GRCm39) missense probably damaging 1.00
R4775:Pglyrp3 UTSW 3 91,933,037 (GRCm39) missense possibly damaging 0.64
R6020:Pglyrp3 UTSW 3 91,938,841 (GRCm39) missense probably damaging 1.00
R7352:Pglyrp3 UTSW 3 91,921,947 (GRCm39) nonsense probably null
R7437:Pglyrp3 UTSW 3 91,937,985 (GRCm39) missense probably benign 0.00
R8150:Pglyrp3 UTSW 3 91,933,790 (GRCm39) missense probably benign 0.00
R8466:Pglyrp3 UTSW 3 91,921,941 (GRCm39) missense probably benign 0.16
R8695:Pglyrp3 UTSW 3 91,933,762 (GRCm39) missense probably null 1.00
R9413:Pglyrp3 UTSW 3 91,930,106 (GRCm39) missense probably damaging 1.00
R9479:Pglyrp3 UTSW 3 91,935,310 (GRCm39) missense probably benign 0.04
R9592:Pglyrp3 UTSW 3 91,938,859 (GRCm39) missense probably benign 0.22
R9722:Pglyrp3 UTSW 3 91,938,695 (GRCm39) missense possibly damaging 0.67
Z1176:Pglyrp3 UTSW 3 91,935,392 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTCTGGCTGTACATTGC -3'
(R):5'- TGCCTGAGCAGTTAAATAGCCC -3'

Sequencing Primer
(F):5'- GGCTGTACATTGCTTTCATAACAGTC -3'
(R):5'- GTTAAATAGCCCAAGCAATAGCCTG -3'
Posted On 2014-09-18