Incidental Mutation 'R2097:Aqp3'
ID 230306
Institutional Source Beutler Lab
Gene Symbol Aqp3
Ensembl Gene ENSMUSG00000028435
Gene Name aquaporin 3
Synonyms RP23-28I8.7, AQP-2, OTTMUSP00000006982, GIL, Gill blood group
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 41092722-41098183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 41098004 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 36 (V36M)
Ref Sequence ENSEMBL: ENSMUSP00000055110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055327]
AlphaFold Q8R2N1
Predicted Effect possibly damaging
Transcript: ENSMUST00000055327
AA Change: V36M

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055110
Gene: ENSMUSG00000028435
AA Change: V36M

DomainStartEndE-ValueType
Pfam:MIP 16 261 5.9e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154722
Meta Mutation Damage Score 0.1539 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the water channel protein aquaporin 3. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein, also known as aquaporin 0. Aquaporin 3 is localized at the basal lateral membranes of collecting duct cells in the kidney. In addition to its water channel function, aquaporin 3 has been found to facilitate the transport of nonionic small solutes such as urea and glycerol, but to a smaller degree. It has been suggested that water channels can be functionally heterogeneous and possess water and solute permeation mechanisms. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Animals homozygous for a mutation in this gene display increased drinking behavior, increased urination, and decreased urine osmolality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Aqp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Aqp3 APN 4 41093632 missense probably damaging 1.00
IGL02994:Aqp3 APN 4 41093614 missense probably benign 0.09
phoebus UTSW 4 41095252 missense probably benign 0.05
R0138:Aqp3 UTSW 4 41094843 splice site probably benign
R2128:Aqp3 UTSW 4 41098061 missense probably benign 0.00
R2129:Aqp3 UTSW 4 41098061 missense probably benign 0.00
R2278:Aqp3 UTSW 4 41093836 missense probably damaging 1.00
R5013:Aqp3 UTSW 4 41093819 missense probably damaging 1.00
R7176:Aqp3 UTSW 4 41095202 missense probably damaging 1.00
R7365:Aqp3 UTSW 4 41098003 missense probably benign 0.14
R7385:Aqp3 UTSW 4 41095178 missense probably damaging 0.97
R9282:Aqp3 UTSW 4 41093640 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGGTAAGTAGCACTGTCACAAG -3'
(R):5'- TCAGCAGGCTGAGCGTATAAAG -3'

Sequencing Primer
(F):5'- GCACTGTCACAAGTTGAGTTAG -3'
(R):5'- TATAAAGGGCGCCACCTGC -3'
Posted On 2014-09-18