Incidental Mutation 'R2097:Tmem132b'
ID 230309
Institutional Source Beutler Lab
Gene Symbol Tmem132b
Ensembl Gene ENSMUSG00000070498
Gene Name transmembrane protein 132B
Synonyms
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 125609449-125869647 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125715272 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 327 (I327K)
Ref Sequence ENSEMBL: ENSMUSP00000031446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031446]
AlphaFold F7BAB2
Predicted Effect probably damaging
Transcript: ENSMUST00000031446
AA Change: I327K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031446
Gene: ENSMUSG00000070498
AA Change: I327K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM132D_N 44 173 2.9e-53 PFAM
Pfam:TMEM132 432 774 5.9e-145 PFAM
Pfam:TMEM132D_C 870 953 1.3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184422
Meta Mutation Damage Score 0.4087 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Tmem132b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Tmem132b APN 5 125,775,792 (GRCm39) missense probably benign
IGL01518:Tmem132b APN 5 125,855,855 (GRCm39) missense probably damaging 1.00
IGL02542:Tmem132b APN 5 125,699,558 (GRCm39) missense probably damaging 1.00
IGL02652:Tmem132b APN 5 125,864,639 (GRCm39) missense probably damaging 1.00
IGL02671:Tmem132b APN 5 125,855,791 (GRCm39) missense probably damaging 0.97
IGL02951:Tmem132b APN 5 125,864,611 (GRCm39) missense probably damaging 0.99
R0456:Tmem132b UTSW 5 125,864,788 (GRCm39) missense probably damaging 0.99
R0462:Tmem132b UTSW 5 125,862,990 (GRCm39) missense probably damaging 1.00
R0724:Tmem132b UTSW 5 125,860,485 (GRCm39) missense possibly damaging 0.95
R1137:Tmem132b UTSW 5 125,860,606 (GRCm39) missense possibly damaging 0.94
R1168:Tmem132b UTSW 5 125,864,083 (GRCm39) missense probably damaging 0.99
R1418:Tmem132b UTSW 5 125,715,313 (GRCm39) missense probably benign 0.01
R1689:Tmem132b UTSW 5 125,864,678 (GRCm39) missense possibly damaging 0.95
R1744:Tmem132b UTSW 5 125,855,908 (GRCm39) critical splice donor site probably null
R1835:Tmem132b UTSW 5 125,862,963 (GRCm39) missense probably damaging 1.00
R2016:Tmem132b UTSW 5 125,700,080 (GRCm39) missense probably benign
R2033:Tmem132b UTSW 5 125,826,353 (GRCm39) missense probably damaging 0.98
R2114:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2116:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2117:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2870:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R2870:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R3807:Tmem132b UTSW 5 125,864,644 (GRCm39) missense probably damaging 1.00
R4825:Tmem132b UTSW 5 125,860,497 (GRCm39) missense probably benign
R5149:Tmem132b UTSW 5 125,699,989 (GRCm39) missense probably damaging 0.99
R5484:Tmem132b UTSW 5 125,864,797 (GRCm39) missense probably damaging 1.00
R5623:Tmem132b UTSW 5 125,700,416 (GRCm39) missense probably damaging 0.99
R5624:Tmem132b UTSW 5 125,699,710 (GRCm39) missense probably benign 0.04
R5775:Tmem132b UTSW 5 125,715,394 (GRCm39) critical splice donor site probably null
R7012:Tmem132b UTSW 5 125,775,654 (GRCm39) missense probably damaging 1.00
R7142:Tmem132b UTSW 5 125,699,737 (GRCm39) missense probably damaging 1.00
R7308:Tmem132b UTSW 5 125,864,710 (GRCm39) missense possibly damaging 0.88
R7414:Tmem132b UTSW 5 125,864,555 (GRCm39) missense probably damaging 1.00
R7452:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R7650:Tmem132b UTSW 5 125,864,074 (GRCm39) missense probably benign 0.04
R8111:Tmem132b UTSW 5 125,699,857 (GRCm39) missense probably benign 0.00
R8326:Tmem132b UTSW 5 125,864,618 (GRCm39) missense probably damaging 1.00
R8525:Tmem132b UTSW 5 125,715,380 (GRCm39) missense probably benign 0.01
R8900:Tmem132b UTSW 5 125,855,884 (GRCm39) missense probably damaging 0.96
R9147:Tmem132b UTSW 5 125,864,167 (GRCm39) missense probably damaging 1.00
R9148:Tmem132b UTSW 5 125,864,167 (GRCm39) missense probably damaging 1.00
R9179:Tmem132b UTSW 5 125,700,115 (GRCm39) missense probably benign 0.02
R9215:Tmem132b UTSW 5 125,864,180 (GRCm39) missense probably damaging 0.99
R9231:Tmem132b UTSW 5 125,860,531 (GRCm39) missense probably damaging 1.00
R9284:Tmem132b UTSW 5 125,864,711 (GRCm39) missense possibly damaging 0.67
R9311:Tmem132b UTSW 5 125,863,029 (GRCm39) missense possibly damaging 0.56
R9436:Tmem132b UTSW 5 125,775,633 (GRCm39) missense possibly damaging 0.53
R9484:Tmem132b UTSW 5 125,860,420 (GRCm39) missense probably damaging 0.98
R9775:Tmem132b UTSW 5 125,864,566 (GRCm39) missense probably benign 0.07
Z1176:Tmem132b UTSW 5 125,864,950 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AGGGAATCTCCATGTGATACTGATA -3'
(R):5'- TGAGCATGTCTCTCTGTCCC -3'

Sequencing Primer
(F):5'- GGAGGATGATCTCATTCCACACTG -3'
(R):5'- GTCCCTTGCTCTAGTAAACCACAC -3'
Posted On 2014-09-18