Incidental Mutation 'R2097:Tmem132b'
ID230309
Institutional Source Beutler Lab
Gene Symbol Tmem132b
Ensembl Gene ENSMUSG00000070498
Gene Nametransmembrane protein 132B
Synonyms
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2097 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location125531774-125792583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125638208 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 327 (I327K)
Ref Sequence ENSEMBL: ENSMUSP00000031446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031446]
Predicted Effect probably damaging
Transcript: ENSMUST00000031446
AA Change: I327K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031446
Gene: ENSMUSG00000070498
AA Change: I327K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM132D_N 44 173 2.9e-53 PFAM
Pfam:TMEM132 432 774 5.9e-145 PFAM
Pfam:TMEM132D_C 870 953 1.3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184422
Meta Mutation Damage Score 0.4087 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Tmem132b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Tmem132b APN 5 125698728 missense probably benign
IGL01518:Tmem132b APN 5 125778791 missense probably damaging 1.00
IGL02542:Tmem132b APN 5 125622494 missense probably damaging 1.00
IGL02652:Tmem132b APN 5 125787575 missense probably damaging 1.00
IGL02671:Tmem132b APN 5 125778727 missense probably damaging 0.97
IGL02951:Tmem132b APN 5 125787547 missense probably damaging 0.99
R0456:Tmem132b UTSW 5 125787724 missense probably damaging 0.99
R0462:Tmem132b UTSW 5 125785926 missense probably damaging 1.00
R0724:Tmem132b UTSW 5 125783421 missense possibly damaging 0.95
R1137:Tmem132b UTSW 5 125783542 missense possibly damaging 0.94
R1168:Tmem132b UTSW 5 125787019 missense probably damaging 0.99
R1418:Tmem132b UTSW 5 125638249 missense probably benign 0.01
R1689:Tmem132b UTSW 5 125787614 missense possibly damaging 0.95
R1744:Tmem132b UTSW 5 125778844 critical splice donor site probably null
R1835:Tmem132b UTSW 5 125785899 missense probably damaging 1.00
R2016:Tmem132b UTSW 5 125623016 missense probably benign
R2033:Tmem132b UTSW 5 125749289 missense probably damaging 0.98
R2114:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2116:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2117:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2870:Tmem132b UTSW 5 125638268 missense probably benign
R2870:Tmem132b UTSW 5 125638268 missense probably benign
R3807:Tmem132b UTSW 5 125787580 missense probably damaging 1.00
R4825:Tmem132b UTSW 5 125783433 missense probably benign
R5149:Tmem132b UTSW 5 125622925 missense probably damaging 0.99
R5484:Tmem132b UTSW 5 125787733 missense probably damaging 1.00
R5623:Tmem132b UTSW 5 125623352 missense probably damaging 0.99
R5624:Tmem132b UTSW 5 125622646 missense probably benign 0.04
R5775:Tmem132b UTSW 5 125638330 critical splice donor site probably null
R7012:Tmem132b UTSW 5 125698590 missense probably damaging 1.00
R7142:Tmem132b UTSW 5 125622673 missense probably damaging 1.00
R7308:Tmem132b UTSW 5 125787646 missense possibly damaging 0.88
R7414:Tmem132b UTSW 5 125787491 missense probably damaging 1.00
R7452:Tmem132b UTSW 5 125638268 missense probably benign
R7650:Tmem132b UTSW 5 125787010 missense probably benign 0.04
R8111:Tmem132b UTSW 5 125622793 missense probably benign 0.00
R8326:Tmem132b UTSW 5 125787554 missense probably damaging 1.00
R8525:Tmem132b UTSW 5 125638316 missense probably benign 0.01
Z1176:Tmem132b UTSW 5 125787886 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AGGGAATCTCCATGTGATACTGATA -3'
(R):5'- TGAGCATGTCTCTCTGTCCC -3'

Sequencing Primer
(F):5'- GGAGGATGATCTCATTCCACACTG -3'
(R):5'- GTCCCTTGCTCTAGTAAACCACAC -3'
Posted On2014-09-18