Mutagenetix > Incidental Mutation

Incidental Mutation 'R2097:5430419D17Rik'

230313

Institutional Source

Beutler Lab

Gene Symbol

5430419D17Rik

Ensembl Gene

ENSMUSG00000006204

Gene Name

RIKEN cDNA 5430419D17 gene

Synonyms

MMRRC Submission

040101-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

131174402-131306451 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 131181964 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 29 (R29*)

Ref Sequence

ENSEMBL: ENSMUSP00000150784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050586] [ENSMUST00000124096] [ENSMUST00000208921]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000050586
AA Change: R29*

SMART Domains

Protein: ENSMUSP00000061529
Gene: ENSMUSG00000006204
AA Change: R29*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	85	105	N/A	INTRINSIC
SR	144	244	3.3e-57	SMART
CUB	272	378	1.2e-16	SMART
SR	428	528	3.9e-56	SMART
low complexity region	533	548	N/A	INTRINSIC
CUB	556	667	5.1e-38	SMART
SR	680	780	1.5e-57	SMART
Pfam:CUB	795	840	3.1e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000208921
AA Change: R29*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr8	T	C	14: 29,987,228	V263A	probably damaging	Het
Apol6	T	A	15: 77,047,133		probably null	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Cts6	T	A	13: 61,195,445	N321Y	probably damaging	Het
Dnmt1	A	G	9: 20,909,788	S1269P	probably benign	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Map7	G	T	10: 20,246,616	V143F	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Msh6	A	G	17: 87,985,416	N533S	probably benign	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Trim9	T	C	12: 70,347,159	M4V	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Ttc25	T	A	11: 100,563,582	F398I	possibly damaging	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in 5430419D17Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:5430419D17Rik	APN	7	131238094	splice site	probably null
IGL00848:5430419D17Rik	APN	7	131246724	missense	probably damaging	1.00
IGL00966:5430419D17Rik	APN	7	131243107	nonsense	probably null
IGL01286:5430419D17Rik	APN	7	131246703	missense	probably damaging	1.00
IGL01303:5430419D17Rik	APN	7	131194331	missense	possibly damaging	0.53
IGL01585:5430419D17Rik	APN	7	131244758	missense	probably damaging	0.97
IGL01665:5430419D17Rik	APN	7	131246657	nonsense	probably null
IGL01953:5430419D17Rik	APN	7	131224980	missense	probably benign	0.04
IGL02427:5430419D17Rik	APN	7	131244788	missense	probably damaging	0.99
IGL02508:5430419D17Rik	APN	7	131222830	missense	probably damaging	1.00
IGL02678:5430419D17Rik	APN	7	131228917	missense	probably damaging	1.00
IGL03092:5430419D17Rik	APN	7	131201798	critical splice donor site	probably null
IGL03122:5430419D17Rik	APN	7	131196514	missense	possibly damaging	0.68
IGL03343:5430419D17Rik	APN	7	131246691	missense	probably damaging	1.00
R0011:5430419D17Rik	UTSW	7	131229993	missense	probably damaging	0.99
R0011:5430419D17Rik	UTSW	7	131229993	missense	probably damaging	0.99
R0234:5430419D17Rik	UTSW	7	131194303	splice site	probably null
R0234:5430419D17Rik	UTSW	7	131194303	splice site	probably null
R0268:5430419D17Rik	UTSW	7	131238176	missense	probably damaging	1.00
R0383:5430419D17Rik	UTSW	7	131239539	missense	probably benign	0.05
R0973:5430419D17Rik	UTSW	7	131238182	missense	probably damaging	1.00
R0973:5430419D17Rik	UTSW	7	131238182	missense	probably damaging	1.00
R0974:5430419D17Rik	UTSW	7	131238182	missense	probably damaging	1.00
R1572:5430419D17Rik	UTSW	7	131244831	nonsense	probably null
R1911:5430419D17Rik	UTSW	7	131238089	missense	probably damaging	1.00
R2032:5430419D17Rik	UTSW	7	131243052	missense	probably damaging	1.00
R2221:5430419D17Rik	UTSW	7	131247457	critical splice acceptor site	probably null
R2223:5430419D17Rik	UTSW	7	131247457	critical splice acceptor site	probably null
R2254:5430419D17Rik	UTSW	7	131222905	missense	probably damaging	1.00
R2913:5430419D17Rik	UTSW	7	131182024	missense	possibly damaging	0.90
R2991:5430419D17Rik	UTSW	7	131246700	missense	probably damaging	1.00
R3439:5430419D17Rik	UTSW	7	131188779	critical splice donor site	probably null
R4418:5430419D17Rik	UTSW	7	131247465	missense	possibly damaging	0.86
R4916:5430419D17Rik	UTSW	7	131174477	splice site	probably null
R5488:5430419D17Rik	UTSW	7	131246595	missense	probably damaging	1.00
R5594:5430419D17Rik	UTSW	7	131239523	missense	probably benign	0.12
R5897:5430419D17Rik	UTSW	7	131196551	splice site	probably null
R5898:5430419D17Rik	UTSW	7	131241967	splice site	probably null
R5940:5430419D17Rik	UTSW	7	131238263	missense	probably damaging	1.00
R6170:5430419D17Rik	UTSW	7	131174487	splice site	probably null
R6187:5430419D17Rik	UTSW	7	131270599	intron	probably benign
R6321:5430419D17Rik	UTSW	7	131257006	critical splice donor site	probably null
R6409:5430419D17Rik	UTSW	7	131262071	intron	probably benign
R6432:5430419D17Rik	UTSW	7	131244872	critical splice donor site	probably null
R6481:5430419D17Rik	UTSW	7	131256801	missense	probably benign	0.05
R6750:5430419D17Rik	UTSW	7	131288245	intron	probably benign
R6783:5430419D17Rik	UTSW	7	131226764	missense	probably damaging	0.99
R6836:5430419D17Rik	UTSW	7	131196504	missense	possibly damaging	0.84
R6925:5430419D17Rik	UTSW	7	131222707	missense	possibly damaging	0.92
R6995:5430419D17Rik	UTSW	7	131222671	missense	probably damaging	1.00
R7199:5430419D17Rik	UTSW	7	131235912	nonsense	probably null
R7205:5430419D17Rik	UTSW	7	131277623	critical splice donor site	probably null
R7340:5430419D17Rik	UTSW	7	131277615	missense	unknown
R7354:5430419D17Rik	UTSW	7	131256729	missense	possibly damaging	0.84
R7354:5430419D17Rik	UTSW	7	131272033	missense	unknown
R7434:5430419D17Rik	UTSW	7	131279483	missense	unknown
R7485:5430419D17Rik	UTSW	7	131228833	missense	probably damaging	0.99
R7513:5430419D17Rik	UTSW	7	131272071	missense	unknown
R7562:5430419D17Rik	UTSW	7	131302697	missense	unknown
R7623:5430419D17Rik	UTSW	7	131277566	splice site	probably null
R7782:5430419D17Rik	UTSW	7	131302737	splice site	probably null
R7879:5430419D17Rik	UTSW	7	131243142	missense	probably damaging	0.98
R7935:5430419D17Rik	UTSW	7	131250476	missense	probably damaging	0.96
R7949:5430419D17Rik	UTSW	7	131293595	splice site	probably null
R7964:5430419D17Rik	UTSW	7	131298234	missense	unknown
R7980:5430419D17Rik	UTSW	7	131234777	missense	probably damaging	0.98
R8145:5430419D17Rik	UTSW	7	131296316	missense	unknown
R8673:5430419D17Rik	UTSW	7	131243117	missense	probably damaging	0.99
R8684:5430419D17Rik	UTSW	7	131235959	nonsense	probably null
R8721:5430419D17Rik	UTSW	7	131277606	missense	unknown
R8725:5430419D17Rik	UTSW	7	131273756	missense	unknown
R8727:5430419D17Rik	UTSW	7	131273756	missense	unknown
R8742:5430419D17Rik	UTSW	7	131182012	missense	unknown
R8807:5430419D17Rik	UTSW	7	131244778	missense	probably damaging	0.97
R8822:5430419D17Rik	UTSW	7	131241977	critical splice acceptor site	probably null
R8861:5430419D17Rik	UTSW	7	131259961	nonsense	probably null
R8897:5430419D17Rik	UTSW	7	131265837	missense	unknown
R8900:5430419D17Rik	UTSW	7	131302468	intron	probably benign
R9214:5430419D17Rik	UTSW	7	131222752	missense	possibly damaging	0.89
R9218:5430419D17Rik	UTSW	7	131261999	missense	unknown
R9311:5430419D17Rik	UTSW	7	131257761	missense	unknown
R9323:5430419D17Rik	UTSW	7	131226672	missense	probably damaging	0.96
R9384:5430419D17Rik	UTSW	7	131302675	missense	unknown
R9387:5430419D17Rik	UTSW	7	131261891	missense	unknown
R9417:5430419D17Rik	UTSW	7	131250489	missense	possibly damaging	0.60
R9502:5430419D17Rik	UTSW	7	131235086	missense	possibly damaging	0.61
R9603:5430419D17Rik	UTSW	7	131228914	missense	probably damaging	0.98
R9642:5430419D17Rik	UTSW	7	131246528	missense	probably benign	0.01
Z1088:5430419D17Rik	UTSW	7	131246633	missense	probably damaging	1.00
Z1177:5430419D17Rik	UTSW	7	131265866	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AAAATGGGTTCCAGGGCAC -3'
(R):5'- GAGTGTGGACTGTCTATCCCTG -3'

Sequencing Primer
(F):5'- TCCGTTCCCATGGGCAC -3'
(R):5'- ACTGTCTATCCCTGGGGGC -3'

Posted On

2014-09-18