Incidental Mutation 'R2097:Nlrp6'
ID230314
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene NameNLR family, pyrin domain containing 6
SynonymsNalp6
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2097 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140920902-140929192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140923204 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 408 (T408S)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
Predicted Effect probably damaging
Transcript: ENSMUST00000106045
AA Change: T378S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: T378S

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably damaging
Transcript: ENSMUST00000183845
AA Change: T378S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: T378S

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000184560
AA Change: T408S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: T408S

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Meta Mutation Damage Score 0.1750 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140923124 missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140921796 missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140925190 missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140923500 missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140922435 missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140923420 missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140927487 missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140923486 nonsense probably null
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1472:Nlrp6 UTSW 7 140923495 missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140923046 missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140923093 missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140924113 small deletion probably benign
R2118:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140922163 missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140921655 missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140924093 missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140923584 missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140922717 nonsense probably null
R5442:Nlrp6 UTSW 7 140922190 missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140923490 missense probably damaging 1.00
R5936:Nlrp6 UTSW 7 140922812 nonsense probably null
R6124:Nlrp6 UTSW 7 140923247 missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140927509 missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140927443 missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140923520 missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140922867 missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140921278 start gained probably benign
R7532:Nlrp6 UTSW 7 140925184 missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140923255 missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140923841 missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140922830 missense possibly damaging 0.83
V7732:Nlrp6 UTSW 7 140926648 splice site probably benign
Z1176:Nlrp6 UTSW 7 140922721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCTTGCTAGTGACTACAC -3'
(R):5'- TGATGATCCAGGATGCCCTC -3'

Sequencing Primer
(F):5'- TGACTACACGCCATGCCG -3'
(R):5'- GACACAGCGTTCTCAGCTC -3'
Posted On2014-09-18