Mutagenetix > Incidental Mutation

Incidental Mutation 'R2097:Dnmt1'

230315

Institutional Source

Beutler Lab

Gene Symbol

Dnmt1

Ensembl Gene

ENSMUSG00000004099

Gene Name

DNA methyltransferase (cytosine-5) 1

Synonyms

MTase, Dnmt1o, Cxxc9, MommeD2

MMRRC Submission

040101-MU

Accession Numbers

Genbank: NM_010066

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20907209-20959888 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20909788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1269 (S1269P)

Ref Sequence

ENSEMBL: ENSMUSP00000150433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004202] [ENSMUST00000177754] [ENSMUST00000178110] [ENSMUST00000216540]

AlphaFold

P13864

Predicted Effect

probably benign
Transcript: ENSMUST00000004202
AA Change: S1387P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000004202
Gene: ENSMUSG00000004099
AA Change: S1387P

Domain	Start	End	E-Value	Type
DMAP_binding	16	106	1.7e-13	SMART
low complexity region	121	143	N/A	INTRINSIC
low complexity region	156	166	N/A	INTRINSIC
low complexity region	180	194	N/A	INTRINSIC
low complexity region	273	290	N/A	INTRINSIC
low complexity region	306	328	N/A	INTRINSIC
Pfam:DNMT1-RFD	405	540	4.8e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC
Pfam:zf-CXXC	648	694	2.7e-17	PFAM
low complexity region	701	711	N/A	INTRINSIC
low complexity region	719	731	N/A	INTRINSIC
BAH	758	884	4.62e-31	SMART
BAH	935	1103	1.79e-37	SMART
low complexity region	1110	1124	N/A	INTRINSIC
Pfam:DNA_methylase	1142	1596	1.3e-49	PFAM
low complexity region	1600	1619	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177754
AA Change: S1268P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136982
Gene: ENSMUSG00000004099
AA Change: S1268P

Domain	Start	End	E-Value	Type
low complexity region	3	25	N/A	INTRINSIC
low complexity region	37	47	N/A	INTRINSIC
low complexity region	61	75	N/A	INTRINSIC
low complexity region	154	171	N/A	INTRINSIC
low complexity region	187	209	N/A	INTRINSIC
Pfam:DNMT1-RFD	286	421	3.4e-40	PFAM
low complexity region	491	506	N/A	INTRINSIC
Pfam:zf-CXXC	529	575	2.3e-17	PFAM
low complexity region	582	592	N/A	INTRINSIC
low complexity region	600	612	N/A	INTRINSIC
BAH	639	765	4.62e-31	SMART
BAH	816	984	1.79e-37	SMART
low complexity region	991	1005	N/A	INTRINSIC
Pfam:DNA_methylase	1023	1477	1.3e-49	PFAM
low complexity region	1481	1500	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178110
AA Change: S1268P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136669
Gene: ENSMUSG00000004099
AA Change: S1268P

Domain	Start	End	E-Value	Type
low complexity region	3	25	N/A	INTRINSIC
low complexity region	38	48	N/A	INTRINSIC
low complexity region	62	76	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
Pfam:DNMT1-RFD	287	422	2.6e-40	PFAM
low complexity region	492	507	N/A	INTRINSIC
Pfam:zf-CXXC	530	576	4.7e-17	PFAM
low complexity region	583	593	N/A	INTRINSIC
low complexity region	601	613	N/A	INTRINSIC
BAH	640	766	4.62e-31	SMART
BAH	817	985	1.79e-37	SMART
low complexity region	992	1006	N/A	INTRINSIC
Pfam:DNA_methylase	1024	1478	8e-50	PFAM
low complexity region	1482	1501	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184490

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214964

Predicted Effect

probably benign
Transcript: ENSMUST00000216540
AA Change: S1269P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: This gene encodes a methyltransferase that preferentially methylates cytosines of CpG residues in hemimethylated DNA to generate fully methylated CpG base pairs during DNA replication. This enzyme plays roles in diverse cellular processes including cell cycle regulation, DNA repair, and telomere maintenance. The encoded protein is composed of an N-terminal domain with a nuclear localization sequence and replication fork-targeting domain, a DNA-binding CXXC domain, two bromo-adjacent homology domains, and a C-terminal catalytic domain. Mouse embryonic stem cells mutant for this gene are viable, but when introduced into the germ line, cause a recessive lethal phenotype with mutant embryos displaying stunted growth and developmental defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations causing partial or severe loss of function were homozygous lethal by embryonic day 9.5, with lack of appropriate genomic imprinting observed at several loci. [provided by MGI curators]

Allele List at MGI

All alleles(109) : Targeted, knock-out(5) Targeted, other(11) Gene trapped(92) Chemically induced(1)

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,181,964	R29*	probably null	Het
Actr8	T	C	14: 29,987,228	V263A	probably damaging	Het
Apol6	T	A	15: 77,047,133		probably null	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Cts6	T	A	13: 61,195,445	N321Y	probably damaging	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Map7	G	T	10: 20,246,616	V143F	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Msh6	A	G	17: 87,985,416	N533S	probably benign	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Trim9	T	C	12: 70,347,159	M4V	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Ttc25	T	A	11: 100,563,582	F398I	possibly damaging	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in Dnmt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Dnmt1	APN	9	20910270	missense	possibly damaging	0.94
IGL01093:Dnmt1	APN	9	20909785	missense	possibly damaging	0.88
IGL01160:Dnmt1	APN	9	20917319	missense	possibly damaging	0.90
IGL01704:Dnmt1	APN	9	20910180	missense	probably damaging	1.00
IGL02105:Dnmt1	APN	9	20907882	missense	unknown
IGL02124:Dnmt1	APN	9	20908549	missense	probably damaging	1.00
IGL02188:Dnmt1	APN	9	20941738	nonsense	probably null
IGL02409:Dnmt1	APN	9	20926497	missense	probably benign	0.00
IGL02579:Dnmt1	APN	9	20918120	missense	possibly damaging	0.79
IGL02625:Dnmt1	APN	9	20927146	missense	probably benign	0.01
IGL02794:Dnmt1	APN	9	20936551	missense	probably benign
IGL02795:Dnmt1	APN	9	20927111	missense	probably benign	0.12
IGL02938:Dnmt1	APN	9	20941373	missense	probably benign	0.23
IGL03245:Dnmt1	APN	9	20915760	missense	probably damaging	0.99
IGL03303:Dnmt1	APN	9	20926710	missense	probably benign
Blankslate	UTSW	9	20912225	missense	possibly damaging	0.86
Midrash	UTSW	9	20909793	nonsense	probably null
Rashi	UTSW	9	20922112	missense	possibly damaging	0.94
B5639:Dnmt1	UTSW	9	20907968	splice site	probably benign
BB003:Dnmt1	UTSW	9	20907559	missense	unknown
BB013:Dnmt1	UTSW	9	20907559	missense	unknown
PIT4576001:Dnmt1	UTSW	9	20911775	missense	probably benign	0.28
R0071:Dnmt1	UTSW	9	20908620	missense	probably damaging	0.99
R0180:Dnmt1	UTSW	9	20908620	missense	probably damaging	0.99
R0368:Dnmt1	UTSW	9	20941757	missense	probably damaging	0.99
R0387:Dnmt1	UTSW	9	20918213	missense	probably damaging	1.00
R0529:Dnmt1	UTSW	9	20911550	missense	probably damaging	1.00
R0532:Dnmt1	UTSW	9	20918556	splice site	probably benign
R0612:Dnmt1	UTSW	9	20918193	missense	probably damaging	0.98
R1109:Dnmt1	UTSW	9	20922388	missense	probably damaging	1.00
R1298:Dnmt1	UTSW	9	20941456	missense	probably benign
R1345:Dnmt1	UTSW	9	20908518	missense	probably damaging	1.00
R1472:Dnmt1	UTSW	9	20932176	missense	probably benign	0.28
R1654:Dnmt1	UTSW	9	20936574	missense	possibly damaging	0.75
R1817:Dnmt1	UTSW	9	20927126	missense	probably benign
R1836:Dnmt1	UTSW	9	20918246	missense	probably damaging	1.00
R1957:Dnmt1	UTSW	9	20927146	missense	probably benign	0.01
R1958:Dnmt1	UTSW	9	20927146	missense	probably benign	0.01
R2145:Dnmt1	UTSW	9	20937155	splice site	probably benign
R2326:Dnmt1	UTSW	9	20924146	splice site	probably benign
R4199:Dnmt1	UTSW	9	20938118	missense	probably benign	0.00
R4456:Dnmt1	UTSW	9	20909842	missense	probably damaging	1.00
R4518:Dnmt1	UTSW	9	20911978	missense	probably benign	0.00
R4586:Dnmt1	UTSW	9	20926693	missense	probably benign	0.05
R4836:Dnmt1	UTSW	9	20908558	missense	probably damaging	1.00
R5014:Dnmt1	UTSW	9	20912254	missense	probably benign	0.07
R5338:Dnmt1	UTSW	9	20952719	missense	probably benign	0.44
R5385:Dnmt1	UTSW	9	20918480	missense	probably damaging	1.00
R5579:Dnmt1	UTSW	9	20920205	missense	probably damaging	1.00
R5645:Dnmt1	UTSW	9	20922147	missense	probably damaging	1.00
R5719:Dnmt1	UTSW	9	20912595	missense	possibly damaging	0.86
R5881:Dnmt1	UTSW	9	20952717	missense	probably damaging	0.97
R6039:Dnmt1	UTSW	9	20926420	intron	probably benign
R6039:Dnmt1	UTSW	9	20926420	intron	probably benign
R6143:Dnmt1	UTSW	9	20927134	missense	probably benign	0.30
R6342:Dnmt1	UTSW	9	20909793	nonsense	probably null
R6374:Dnmt1	UTSW	9	20924045	missense	possibly damaging	0.73
R6953:Dnmt1	UTSW	9	20918526	missense	probably benign
R6990:Dnmt1	UTSW	9	20915814	nonsense	probably null
R7089:Dnmt1	UTSW	9	20908489	missense	probably damaging	0.99
R7463:Dnmt1	UTSW	9	20912225	missense	possibly damaging	0.86
R7522:Dnmt1	UTSW	9	20920202	missense	probably damaging	0.99
R7695:Dnmt1	UTSW	9	20913985	missense	probably null	1.00
R7785:Dnmt1	UTSW	9	20922049	missense	probably damaging	0.98
R7926:Dnmt1	UTSW	9	20907559	missense	unknown
R8037:Dnmt1	UTSW	9	20941564	missense	probably damaging	0.99
R8038:Dnmt1	UTSW	9	20941564	missense	probably damaging	0.99
R8424:Dnmt1	UTSW	9	20918540	missense	probably benign	0.07
R8692:Dnmt1	UTSW	9	20941781	missense	probably damaging	1.00
R9016:Dnmt1	UTSW	9	20936559	missense	possibly damaging	0.67
R9101:Dnmt1	UTSW	9	20941543	missense	probably damaging	1.00
R9200:Dnmt1	UTSW	9	20908600	missense	probably benign	0.00
R9248:Dnmt1	UTSW	9	20922112	missense	possibly damaging	0.94
R9317:Dnmt1	UTSW	9	20918279	missense	probably damaging	0.99
R9352:Dnmt1	UTSW	9	20929088	missense	probably benign	0.00
R9438:Dnmt1	UTSW	9	20915894	missense	probably benign
RF003:Dnmt1	UTSW	9	20910131	nonsense	probably null
RF004:Dnmt1	UTSW	9	20910127	nonsense	probably null
RF011:Dnmt1	UTSW	9	20910128	nonsense	probably null
RF011:Dnmt1	UTSW	9	20910144	nonsense	probably null
RF015:Dnmt1	UTSW	9	20910124	nonsense	probably null
RF015:Dnmt1	UTSW	9	20910129	nonsense	probably null
RF017:Dnmt1	UTSW	9	20910126	nonsense	probably null
RF023:Dnmt1	UTSW	9	20910131	nonsense	probably null
RF024:Dnmt1	UTSW	9	20910130	nonsense	probably null
RF024:Dnmt1	UTSW	9	20910138	small insertion	probably benign
RF025:Dnmt1	UTSW	9	20910120	nonsense	probably null
RF025:Dnmt1	UTSW	9	20910135	nonsense	probably null
RF029:Dnmt1	UTSW	9	20910123	nonsense	probably null
RF034:Dnmt1	UTSW	9	20910120	nonsense	probably null
RF037:Dnmt1	UTSW	9	20910119	critical splice donor site	probably benign
RF037:Dnmt1	UTSW	9	20910133	nonsense	probably null
RF037:Dnmt1	UTSW	9	20910141	nonsense	probably null
RF042:Dnmt1	UTSW	9	20910119	nonsense	probably null
RF045:Dnmt1	UTSW	9	20910129	nonsense	probably null
RF045:Dnmt1	UTSW	9	20910137	small insertion	probably benign
RF047:Dnmt1	UTSW	9	20910125	nonsense	probably null
RF048:Dnmt1	UTSW	9	20910126	nonsense	probably null
RF054:Dnmt1	UTSW	9	20910139	nonsense	probably null
RF055:Dnmt1	UTSW	9	20910128	nonsense	probably null
RF055:Dnmt1	UTSW	9	20910135	nonsense	probably null
RF055:Dnmt1	UTSW	9	20910136	small insertion	probably benign
RF059:Dnmt1	UTSW	9	20910138	small insertion	probably benign
RF059:Dnmt1	UTSW	9	20910139	nonsense	probably null
RF060:Dnmt1	UTSW	9	20910142	nonsense	probably null
RF061:Dnmt1	UTSW	9	20910130	nonsense	probably null
X0026:Dnmt1	UTSW	9	20913914	missense	probably damaging	1.00
Z1176:Dnmt1	UTSW	9	20915863	missense	probably damaging	0.99
Z1176:Dnmt1	UTSW	9	20926554	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAGAGATGTTGAGCCTTGAG -3'
(R):5'- AAGGTCTGCACCATTCCACC -3'

Sequencing Primer
(F):5'- CTTGAGGCCCGTGGAAGTG -3'
(R):5'- GCAGAACCTGAGCAGAGCC -3'

Posted On

2014-09-18