Incidental Mutation 'R2097:Bace1'
ID 230316
Institutional Source Beutler Lab
Gene Symbol Bace1
Ensembl Gene ENSMUSG00000032086
Gene Name beta-site APP cleaving enzyme 1
Synonyms
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.380) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 45749878-45775694 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 45771520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 478 (C478F)
Ref Sequence ENSEMBL: ENSMUSP00000034591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034591] [ENSMUST00000058720] [ENSMUST00000078111] [ENSMUST00000160699] [ENSMUST00000161187] [ENSMUST00000161203] [ENSMUST00000162369] [ENSMUST00000162699]
AlphaFold P56818
Predicted Effect probably benign
Transcript: ENSMUST00000034591
AA Change: C478F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034591
Gene: ENSMUSG00000032086
AA Change: C478F

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 418 3.1e-46 PFAM
Pfam:TAXi_C 259 417 1.2e-13 PFAM
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058720
SMART Domains Protein: ENSMUSP00000060941
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078111
AA Change: C444F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077249
Gene: ENSMUSG00000032086
AA Change: C444F

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 295 9.5e-34 PFAM
Pfam:TAXi_C 290 383 1.5e-8 PFAM
transmembrane domain 421 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159499
SMART Domains Protein: ENSMUSP00000124773
Gene: ENSMUSG00000032086

DomainStartEndE-ValueType
Pfam:Asp 4 61 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159970
Predicted Effect probably benign
Transcript: ENSMUST00000160699
SMART Domains Protein: ENSMUSP00000123754
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161187
SMART Domains Protein: ENSMUSP00000124296
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
coiled coil region 65 224 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 465 509 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161203
SMART Domains Protein: ENSMUSP00000123995
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
SCOP:d1eq1a_ 80 227 2e-5 SMART
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 500 544 3.42e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162209
Predicted Effect unknown
Transcript: ENSMUST00000162587
AA Change: C336F
SMART Domains Protein: ENSMUSP00000124960
Gene: ENSMUSG00000032086
AA Change: C336F

DomainStartEndE-ValueType
Pfam:Asp 1 75 3.6e-9 PFAM
Pfam:Asp 78 277 3.3e-22 PFAM
Pfam:TAXi_C 118 276 1.4e-15 PFAM
transmembrane domain 314 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216609
Predicted Effect probably benign
Transcript: ENSMUST00000162699
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. Homozygous knockout mice for this gene exhibit a wide range of nervous system defects, growth retardation, metabolic abnormalities, and increased neonatal lethality. [provided by RefSeq, Nov 2015]
PHENOTYPE: Some alleles with a targeted mutation exhibit small body size, postnatal lethality, hyperactivity, decreased anxiety, and abnormal APP processing by neurons, while others appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Bace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Bace1 APN 9 45,750,588 (GRCm39) critical splice donor site probably null
IGL03378:Bace1 APN 9 45,770,199 (GRCm39) splice site probably null
R0071:Bace1 UTSW 9 45,765,997 (GRCm39) intron probably benign
R1561:Bace1 UTSW 9 45,750,492 (GRCm39) missense probably benign 0.08
R1819:Bace1 UTSW 9 45,768,460 (GRCm39) missense possibly damaging 0.48
R4067:Bace1 UTSW 9 45,765,962 (GRCm39) missense probably damaging 1.00
R4864:Bace1 UTSW 9 45,766,109 (GRCm39) missense probably damaging 1.00
R5814:Bace1 UTSW 9 45,771,562 (GRCm39) missense probably damaging 1.00
R5818:Bace1 UTSW 9 45,770,347 (GRCm39) missense possibly damaging 0.94
R6365:Bace1 UTSW 9 45,765,974 (GRCm39) nonsense probably null
R6968:Bace1 UTSW 9 45,766,263 (GRCm39) splice site probably null
R7188:Bace1 UTSW 9 45,767,393 (GRCm39) missense probably benign
R7517:Bace1 UTSW 9 45,771,559 (GRCm39) missense probably benign 0.32
R7560:Bace1 UTSW 9 45,767,437 (GRCm39) missense possibly damaging 0.50
R7729:Bace1 UTSW 9 45,769,743 (GRCm39) missense probably damaging 1.00
R8222:Bace1 UTSW 9 45,768,491 (GRCm39) missense probably damaging 1.00
R9268:Bace1 UTSW 9 45,767,282 (GRCm39) intron probably benign
X0020:Bace1 UTSW 9 45,771,480 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGTAAGAGCTACCGGTTCATC -3'
(R):5'- CCAGAAGCATTGGCAGGTTG -3'

Sequencing Primer
(F):5'- GTAAGAGCTACCGGTTCATCTCCAC -3'
(R):5'- AGGGTCCTGAGGTGCTC -3'
Posted On 2014-09-18