Incidental Mutation 'R2097:Bace1'
ID230316
Institutional Source Beutler Lab
Gene Symbol Bace1
Ensembl Gene ENSMUSG00000032086
Gene Namebeta-site APP cleaving enzyme 1
Synonyms
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R2097 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45838580-45864399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45860222 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 478 (C478F)
Ref Sequence ENSEMBL: ENSMUSP00000034591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034591] [ENSMUST00000058720] [ENSMUST00000078111] [ENSMUST00000160699] [ENSMUST00000161187] [ENSMUST00000161203] [ENSMUST00000162369] [ENSMUST00000162699]
Predicted Effect probably benign
Transcript: ENSMUST00000034591
AA Change: C478F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034591
Gene: ENSMUSG00000032086
AA Change: C478F

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 418 3.1e-46 PFAM
Pfam:TAXi_C 259 417 1.2e-13 PFAM
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058720
SMART Domains Protein: ENSMUSP00000060941
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078111
AA Change: C444F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077249
Gene: ENSMUSG00000032086
AA Change: C444F

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 295 9.5e-34 PFAM
Pfam:TAXi_C 290 383 1.5e-8 PFAM
transmembrane domain 421 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159499
SMART Domains Protein: ENSMUSP00000124773
Gene: ENSMUSG00000032086

DomainStartEndE-ValueType
Pfam:Asp 4 61 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159970
Predicted Effect probably benign
Transcript: ENSMUST00000160699
SMART Domains Protein: ENSMUSP00000123754
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161187
SMART Domains Protein: ENSMUSP00000124296
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
coiled coil region 65 224 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 465 509 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161203
SMART Domains Protein: ENSMUSP00000123995
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
SCOP:d1eq1a_ 80 227 2e-5 SMART
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 500 544 3.42e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162209
Predicted Effect probably benign
Transcript: ENSMUST00000162369
Predicted Effect unknown
Transcript: ENSMUST00000162587
AA Change: C336F
SMART Domains Protein: ENSMUSP00000124960
Gene: ENSMUSG00000032086
AA Change: C336F

DomainStartEndE-ValueType
Pfam:Asp 1 75 3.6e-9 PFAM
Pfam:Asp 78 277 3.3e-22 PFAM
Pfam:TAXi_C 118 276 1.4e-15 PFAM
transmembrane domain 314 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216609
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. Homozygous knockout mice for this gene exhibit a wide range of nervous system defects, growth retardation, metabolic abnormalities, and increased neonatal lethality. [provided by RefSeq, Nov 2015]
PHENOTYPE: Some alleles with a targeted mutation exhibit small body size, postnatal lethality, hyperactivity, decreased anxiety, and abnormal APP processing by neurons, while others appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Bace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Bace1 APN 9 45839290 critical splice donor site probably null
IGL03378:Bace1 APN 9 45858901 splice site probably null
R0071:Bace1 UTSW 9 45854699 intron probably benign
R1561:Bace1 UTSW 9 45839194 missense probably benign 0.08
R1819:Bace1 UTSW 9 45857162 missense possibly damaging 0.48
R4067:Bace1 UTSW 9 45854664 missense probably damaging 1.00
R4864:Bace1 UTSW 9 45854811 missense probably damaging 1.00
R5814:Bace1 UTSW 9 45860264 missense probably damaging 1.00
R5818:Bace1 UTSW 9 45859049 missense possibly damaging 0.94
R6365:Bace1 UTSW 9 45854676 nonsense probably null
R6968:Bace1 UTSW 9 45854965 splice site probably null
R7188:Bace1 UTSW 9 45856095 missense probably benign
R7517:Bace1 UTSW 9 45860261 missense probably benign 0.32
R7560:Bace1 UTSW 9 45856139 missense possibly damaging 0.50
R7729:Bace1 UTSW 9 45858445 missense probably damaging 1.00
R8222:Bace1 UTSW 9 45857193 missense probably damaging 1.00
X0020:Bace1 UTSW 9 45860182 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGTAAGAGCTACCGGTTCATC -3'
(R):5'- CCAGAAGCATTGGCAGGTTG -3'

Sequencing Primer
(F):5'- GTAAGAGCTACCGGTTCATCTCCAC -3'
(R):5'- AGGGTCCTGAGGTGCTC -3'
Posted On2014-09-18